Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing II-type pig's ring-virus nucleic vaccine and the use thereof

A technology of nucleic acid vaccine and circovirus, which is applied in the new field of biology, can solve the problems of economic losses in the pig industry, no conventional vaccines for type II porcine circovirus, and difficulty in producing high-titer virus particles, so as to prevent pollution , high safety and short production cycle

Inactive Publication Date: 2005-02-16
ZHEJIANG UNIV
View PDF0 Cites 42 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PMWS has caused significant economic losses to the pig industry, and the development of PCV2 vaccines has become an urgent problem to be solved
[0003] Conventional vaccines include inactivated vaccines or attenuated vaccines, but because PCV2 does not produce cytopathic changes in cell culture, it is difficult to produce high-titer virus particles, it is very inconvenient to prepare PCV2 vaccines with conventional techniques, and there is no conventional type II porcine circovirus so far. vaccine available

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing II-type pig's ring-virus nucleic vaccine and the use thereof
  • Method for preparing II-type pig's ring-virus nucleic vaccine and the use thereof
  • Method for preparing II-type pig's ring-virus nucleic vaccine and the use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: the construction of type II porcine circovirus nucleic acid ORF1~ORF4 eukaryotic expression vector

[0032] According to the gene sequence of PCV2 strain HZ0201, specific primers for PCV2 ORF1, ORF2, ORF3, and ORF4 genes were designed respectively. The primer sequences are as follows:

[0033] Primers for PCV2 ORF1 gene:

[0034] f1p1:ATAACGCGTCATGCCCAGCAAGAAG

[0035] f1p2: GCGGTCGACGACTCAGTAATTTTATTTCATATGG

[0036] Primers for PCV2 ORF2 gene:

[0037] f2ms1: GCGGTCGACTCATTAAGGGTTAAGTGGG

[0038] f2ms2: TATACGCGTTTATGACGTATCCAAGGAGG

[0039] Primers for PCV2 ORF3 gene:

[0040] f3P1: TAAGTCGACCTTACTGATGGAGTGTGG

[0041] f3P2: ATAACGCGTATGGTAACCATCCCAC

[0042] Primers for PCV2 ORF4 gene:

[0043] f4P1: TATGTCGACTCTCAGGGACAACGG

[0044] f4P2: ATAACGCGTCAATGACGTGTACATTAGTCT

[0045] The above upstream and downstream primers were respectively introduced into MluI and SalI sites.

[0046] At the same time, according to the sequence of the pCI-neo ...

Embodiment 2

[0051] Example 2: Construction of porcine IL2, IL4 and IFN-γ eukaryotic expression vectors

[0052] Take 10ml of healthy large gram pig blood, separate lymphocytes with lymphocyte separation medium, suspend in RPM11640 comprehensive medium, and dilute the cell suspension to 2×10 6 / ml, add conA to a final concentration of 10mg / ml, place in a cell culture plate, and culture in a CO2 incubator at 37°C for 48h. Then the total RNA was extracted from the cultured cells with Trizol Reagent. According to the published porcine IL2, IL4 and IFN-γ cDNA sequences, design upstream and downstream primers:

[0053] Porcine IL2 primers:

[0054] PIL21: ATAACGCGTCAATGTATAAGATGCAG

[0055] PIL22: TCAGTCGACTTATCAAGTCAGTGTTG

[0056] Porcine IL4 primers:

[0057] PIL41: ATAACGCGTGCTCTATTCATGGG

[0058] PIL42: TATGTCGACTTCAACACTTTGAGTAT

[0059] Porcine IFN-γ primers:

[0060] IF1: ATAACGCGTACAATGAGTTATACAAC

[0061] IF2: TAGGTCGACACAATTATTTTGATGCT

[0062] The above upstream and downst...

Embodiment 3

[0064] Embodiment 3: Construction of the fusion expression vector of PCV2 ORF2 and other genes of PCV2

[0065] Design primers, use PCV2 genome as a template, and amplify PCV2 ORF2 gene by PCR method. The ORF4 vectors were connected to construct pCI-PCV2-ORF2-ORF1, pCI-PCV2-ORF2-ORF3, and pCI-PCV2-ORF2-ORF4 fusion expression vectors.

[0066] The amplification primers of PCV2 ORF2 are:

[0067] pCI-PCV2-ORF2-ORF1:

[0068] f2xm1: TCTCTCGAGTATGACGTATCCAAGGAGGC

[0069] f2xm21: TAGACGCGTAAAGGGTTAAGTGGGGGT

[0070] pCI-PCV2-ORF2-ORF3:

[0071] f2xm1: TCTCTCGAGTATGACGTATCCAAGGAGGC

[0072] f2xm20: TAGACGCGTAGGGTTAAGTGGGGGT

[0073] pCI-PCV2-ORF2-ORF4:

[0074] f2xm1: TCTCTCGAGTATGACGTATCCAAGGAGGC

[0075] f2xm22: TAGACGCGTAAGGGTTAAGTGGGGGT

[0076] The PCR program was: denaturation at 95°C for 10 min, followed by 35 cycles of 94°C for 40 s, 52°C for 40 s, and 72°C for 50 s, and finally extension at 72°C for 10 min.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a manufacturing method and application of II type pig ring virus nucleic acid vaccine. The method is: 1) designs the specific primer, uses PCV2 Hangzhou (HZ201) gene group as template, closes ORF1, ORF2, ORF3 and ORF4 genes of PCV-2 with PCR method, and they are constructed into eucaryon expressing carrier with pCI-neo; 2) separates the pig external blood single nucleus cell, clones the genes IFN, IL-2 and IL-4 with RT-PCR method, and they are constructed into eucaryon expressing carrier with pCI-neo; 3) based on above mentioned reconstructed carrier, constructs the fused expressing carrier of the other genes of PCV2, ORF2 and PCV2 or pig cell factor gene; the merits of the invention lie in: (1) it needs not to culture virus, the producing period is short; (2) it needs not cell culture, thus can prevent the contamination from other pig source virus; (3) it does not express the pathogenesis protein which is harmful to body, the safety is high. (4) it can activates body secretion and cell immunity replay at the same time.

Description

technical field [0001] The invention relates to the field of biological technology, in particular to a preparation method and application of a type II porcine circovirus nucleic acid vaccine. Background technique [0002] Weaned Piglet Multisystemic Weakness Syndrome (PMWS) is a new swine disease that first occurred in Canada in 1997, manifested as progressive emaciation, dyspnea, pale skin, diarrhea, and jaundice. In 1998, Ellis et al. isolated the pathogen of the disease for the first time, which was type II porcine circovirus (PCV2). Lang Hongwu etc. (2000) showed that the total positive rate of PCV2 was 42.9% to 559 samples of sera from 22 pig herds in 7 provinces (cities) of Beijing, Hebei, Shandong, Tianjin, Jiangxi, Jilin and Henan. Zhou Jiyong et al. collected 1677 pig sera from 28 pig farms in Hangzhou, Zhejiang Province, and used the IFA test to detect PCV2 antibodies in the serum. The results showed that the total positive rate of PCV2 antibodies was 57.25%, indi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/12A61K48/00A61P31/12
Inventor 周继勇申会刚郭军庆
Owner ZHEJIANG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More