Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel vaccine of tumor antigen, its preparation method and vaccine composition

A tumor antigen and vaccine technology, which is applied in the fields of bioengineering and medicine, can solve problems such as weak combination of antigen and antibody, difficulty in preparing human antibody, and affecting antigen delivery effect, and achieves improved T cell activation effect, simple method, The effect of enhancing antigenicity

Inactive Publication Date: 2004-03-17
李进
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the way of antigen-antibody complex to activate DC also has its drawbacks. First, the preparation of antigen and antibody should be carried out separately, especially the preparation of human antibody is still quite difficult.
Second, the activation of DC also requires the participation of inflammatory factors (that is, danger signals). In the absence of inflammatory factors, the activation of DC will be greatly affected
Third, the combination of antigen and antibody is not firm. Under the influence of certain factors, the antigen will break away from the antibody and affect the antigen delivery effect.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: MUC1 Tumor Antigen Vaccine

[0044] The full sequence of MUC1 can be retrieved from GenBank (NM...002456). Using the Invitrogene company's reverse transcription kit, according to the manufacturer's instructions, cDNA was synthesized from X-108 gastric cancer cell line (gastric cancer cell line derived from surgical specimens) by mRNA reverse transcription method to obtain MUC1 DNA.

[0045]Similarly, cDNA was reverse-transcribed from human B lymphocyte mRNA to obtain CH3 DNA using the Invitrogene company's reverse transcription kit according to the manufacturer's instructions. The DNA sequence of CH3 is shown as SEQ ID NO: 2 in the sequence listing.

[0046] MUC1 was synthesized by using the DNA of MUC1 obtained above as a template PCR method (5' PCR primer sequence AACCCGGTACCACAGGTTCTGGTCATGCAAGC (SEQ ID NO: 3), 3' PCR primer sequence AACCCCCTCGAGGGGGGCGGTGGAGCCCGGGGCC (SEQ ID NO: 4)). MUC1 was cloned into the multiple cloning site of pcDNA3.1 vector (pur...

Embodiment 2

[0051] Example 2: CEA Tumor Antigen Vaccine (CAP-1)

[0052] First, use the Invitrogene reverse transcription kit to operate according to the manufacturer's instructions, and synthesize cDNA from human B lymphocyte mRNA by reverse transcription to obtain the DNA of the Fc segment. The DNA sequence of the Fc segment is shown in SEQ ID NO: 7 in the sequence listing.

[0053] The DNA coding sequence of CAP-1 is known as TACCTTTCGGGAGCGAACCTCAACCTCTCC (SEQ ID NO: 8), and the DNA of the CAP-1-Fc recombinant protein was synthesized by PCR method using the above obtained Fc segment cDNA as a template (5'PCR primer sequence AACCCGGTACCATGTACCTTTCGGGAGCGAACCTCAACCTCTCCGCAGAGCCCAAATCTTGTGA (SEQ ID NO: 8) ID NO: 9), 3' PCR primer sequence AACCCTCTAGATTATCATTTACCCGGAGA (SEQ ID NO: 10)). CAP-1-Fc was cloned into the corresponding site in the pcDNA3.1 vector with restriction endonuclease Xho I / Xba I, so that CAP-1 and Fc were connected in series.

[0054] After pcDNA3.1 was amplified in D...

Embodiment 3

[0058] Example 3: P53 Tumor Antigen Vaccine

[0059] The full sequence of human P53 can be retrieved from GenBank (M14695). The plasmid containing the P53 gene can be purchased from ATCC, USA, and its complete amino acid sequence is shown in SEQ ID NO:11. Similarly, cDNA was reverse-transcribed from human B lymphocyte mRNA to obtain CH3 DNA using the Invitrogene company's reverse transcription kit according to the manufacturer's instructions.

[0060] Using the P53 DNA obtained above as a template, P53 was synthesized by PCR method (5' PCR primer sequence AACCCGGTACCATGGAGGAGCCGCAGTCAGAT (SEQ ID NO: 12), 3' PCR primer sequence AACCCCCTCGAGGTCTGAGTCAGGCCCTTC (SEQ ID NO: 13)). P53 was cloned into the multiple cloning site of pcDNA3.1 vector (purchased from Invitrogene) with restriction endonuclease Kpn I / Xho I. Similarly, the CH3 fragment of immunoglobulin Fc was synthesized by PCR using the CH3 DNA obtained above as a template (5' PCR primer sequence AACCCTCTCGAGGGCAGCCCCGAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The new tumor antigen vaccine includes sequence with seven or more amino acids from tumor antigen and CH3 part amino acid sequence of immune globulin, and the two sequences are connected mutually. The NDA sequence encoding the tumor antigen vaccine, its preparation process and the vaccine composition containing the tumor antigen vaccine are also disclosed. The vaccine of the present invention has molecular weight many times smaller than that of antigen-antibody composition, and is easy to be phagocytized by dendritic cell to produce powerful immunological effect.

Description

technical field [0001] The invention relates to the fields of bioengineering and medicine. More specifically, the present invention relates to a novel tumor antigen vaccine, its preparation method and vaccine composition. Background of the invention [0002] Tumor is still one of the main causes of death of human beings. Although the level of diagnosis and treatment of tumors has been continuously improved and improved in recent years, and the regimens of chemotherapy and radiotherapy have also been continuously improved, but in the end most patients still cannot escape the bad luck of death. In recent years, advances in molecular biology and further understanding of the function of the immune system have led to a rapid development of research and development of biotherapeutic methods. The development of tumor vaccines is one of the most important directions of tumor biotherapy [1-3]. [0003] Although the humoral immune system may generate some anti-tumor immune response...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/00C07K19/00
CPCC07K2319/00A61K39/0011C07K19/00A61K39/00A61P35/00
Inventor 李进
Owner 李进
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com