Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage
A hepatitis C virus and recombinant protein technology, applied in the field of genetic engineering, can solve the problem of ineffective activation of CTL
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Embodiment 1 obtains the coding gene of BCG 65KD heat shock protein (HSP65)
[0064] BCG was obtained from Changchun Institute of Biological Products. Sutong potato medium (StarchPotato Code No: C250-1, Sigma subpackaged Beijing Dingguo Biotechnology) was used to cultivate at a temperature of 37-39°C, and the grown BCG showed a dry wrinkled light yellow pellicle. The pellicles were collected from which BCG genomic DNA was extracted.
[0065] The method for extracting BCG genomic DNA refers to Molecular Cloning (J.Sambrook, Isolation of high-molecular-weight DNA from mammalian cells), 9.16-9.22, ColdSpring Harbor Laboratory Press, Molecular cloning, 1989 ).
[0066] Heat shock protein 65 (HSP65) structural gene was isolated from BCG by PCR method. The 5' end primer sequence used is 5'CCATG GCC AAG ACA ATT GCG3' ( SEQ ID NO: 21), the 3' end primer sequence is 5' ACC GAA TTC GCT AGC CAT ATG GAA ATC CATGCC ACC CAT 3' ( SEQ ID NO: 22).
[0067] The PCR operating proced...
Embodiment 2
[0079] Example 2. Synthetic single-copy multi-epitope HCV core antigen gene
[0080]A single-copy multi-epitope HCV core antigen gene was synthesized by two rounds of PCR synthesis. 1) The first round of PCR (the two primers serve as templates for each other to amplify) the sequence of primer 1 is: 5′ATGGGTTACATCCCGCTGGTTGGTGCTCCGCTGGAAGACTCTGAAGGTGTTTACCTGCTGCCGCGTCGTGGG CCGCGCCTGGGCGTTCGC 3' ( SEQ ID NO: 10) The sequence of primer 1' is: 5'GTCGTTACGTTCAGAAGTTTTACGAGTAGCACGAACACCCAGACGCGGACCTTCGATTTCGTCGTTTTCAGC GCGAACGCCCAGGCGCGG 3' ( SEQ ID NO: 11)
[0081] The PCR operating procedure is: add the following reagents in a 500 μl microcentrifuge tube:
[0082] 2 μl each of Primer 1 and Primer 1’
[0083] 10×PCR buffer (see product description for ingredients of Beijing Dingguo Company) 5 μl
[0084] dNTPs (10mmol / L) 1μl
[0085] Taq DNA polymerase (2u / μl) 1μl
[0086] Add deionized water to a final volume of 50 μl
[0087] After mixing add 2 drops of mineral oil ...
Embodiment 3
[0119] Cloning of BCG HSP-65 Gene
[0120] The plasmid obtained in Example 1 was digested with NcoI (Takara) and EcoRI (Takara) at 37°C for 2 hours. Digested products were separated by agarose gel electrophoresis. The electrophoresis conditions are: 1% agarose gel, 1×TAE buffer solution, 150-200mA, electrophoresis for 0.5-1 hour. 20×TAE buffer: 0.8mol / L Tris base, 0.4mol / L NaOAc, 0.04mol / L Na 2 EDTA, adjusted to pH 8.3 with glacial acetic acid.
[0121] Observe and excise the DNA electrophoresis band on the agarose gel under ultraviolet light. Cut out the agarose gel containing the DNA band, freeze at -70°C for 15 minutes; after melting at room temperature, centrifuge at 12,000rpm for 5 minutes, transfer the upper liquid phase to another tube, and use 2-2.5 times ethanol to precipitate, Wash and dry DNA.
[0122] The recovered DNA fragments were cloned into the 6 polyhistidine (histidine) code of the prokaryotic cell expression vector pET-28a (+) plasmid (U.S. Novagen) di...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap