Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage

A hepatitis C virus and recombinant protein technology, applied in the field of genetic engineering, can solve the problem of ineffective activation of CTL

Inactive Publication Date: 2003-12-24
BEIJING HYDVAX BIOTECH
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Studies have shown that after immunizing the human body, exogenous protein antigens are usually taken up and processed by antigen-presenting cells, and enter the MHC class II presentation pathway, which can stimulate humoral immune responses (Heikema A, Agsteribbe E, Wilschut J, Huckriede A .Generation of heat shock protein-based vaccines by intracellular loading of gp96 with antigenic peptides. Immunol Lett 1997 Jun 1; 57(1-3) :69-74), but cannot effectively activate the production of specific CTL

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage
  • Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage
  • Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Embodiment 1 obtains the coding gene of BCG 65KD heat shock protein (HSP65)

[0064] BCG was obtained from Changchun Institute of Biological Products. Sutong potato medium (StarchPotato Code No: C250-1, Sigma subpackaged Beijing Dingguo Biotechnology) was used to cultivate at a temperature of 37-39°C, and the grown BCG showed a dry wrinkled light yellow pellicle. The pellicles were collected from which BCG genomic DNA was extracted.

[0065] The method for extracting BCG genomic DNA refers to Molecular Cloning (J.Sambrook, Isolation of high-molecular-weight DNA from mammalian cells), 9.16-9.22, ColdSpring Harbor Laboratory Press, Molecular cloning, 1989 ).

[0066] Heat shock protein 65 (HSP65) structural gene was isolated from BCG by PCR method. The 5' end primer sequence used is 5'CCATG GCC AAG ACA ATT GCG3' ( SEQ ID NO: 21), the 3' end primer sequence is 5' ACC GAA TTC GCT AGC CAT ATG GAA ATC CATGCC ACC CAT 3' ( SEQ ID NO: 22).

[0067] The PCR operating proced...

Embodiment 2

[0079] Example 2. Synthetic single-copy multi-epitope HCV core antigen gene

[0080]A single-copy multi-epitope HCV core antigen gene was synthesized by two rounds of PCR synthesis. 1) The first round of PCR (the two primers serve as templates for each other to amplify) the sequence of primer 1 is: 5′ATGGGTTACATCCCGCTGGTTGGTGCTCCGCTGGAAGACTCTGAAGGTGTTTACCTGCTGCCGCGTCGTGGG CCGCGCCTGGGCGTTCGC 3' ( SEQ ID NO: 10) The sequence of primer 1' is: 5'GTCGTTACGTTCAGAAGTTTTACGAGTAGCACGAACACCCAGACGCGGACCTTCGATTTCGTCGTTTTCAGC GCGAACGCCCAGGCGCGG 3' ( SEQ ID NO: 11)

[0081] The PCR operating procedure is: add the following reagents in a 500 μl microcentrifuge tube:

[0082] 2 μl each of Primer 1 and Primer 1’

[0083] 10×PCR buffer (see product description for ingredients of Beijing Dingguo Company) 5 μl

[0084] dNTPs (10mmol / L) 1μl

[0085] Taq DNA polymerase (2u / μl) 1μl

[0086] Add deionized water to a final volume of 50 μl

[0087] After mixing add 2 drops of mineral oil ...

Embodiment 3

[0119] Cloning of BCG HSP-65 Gene

[0120] The plasmid obtained in Example 1 was digested with NcoI (Takara) and EcoRI (Takara) at 37°C for 2 hours. Digested products were separated by agarose gel electrophoresis. The electrophoresis conditions are: 1% agarose gel, 1×TAE buffer solution, 150-200mA, electrophoresis for 0.5-1 hour. 20×TAE buffer: 0.8mol / L Tris base, 0.4mol / L NaOAc, 0.04mol / L Na 2 EDTA, adjusted to pH 8.3 with glacial acetic acid.

[0121] Observe and excise the DNA electrophoresis band on the agarose gel under ultraviolet light. Cut out the agarose gel containing the DNA band, freeze at -70°C for 15 minutes; after melting at room temperature, centrifuge at 12,000rpm for 5 minutes, transfer the upper liquid phase to another tube, and use 2-2.5 times ethanol to precipitate, Wash and dry DNA.

[0122] The recovered DNA fragments were cloned into the 6 polyhistidine (histidine) code of the prokaryotic cell expression vector pET-28a (+) plasmid (U.S. Novagen) di...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A recombinant protein vaccine which is a fusion protein of BCG vaccine's heat shock protein 65 and the core antigen of multi-epitope hepatitis-C virus, its amino acid sequence and nucleotide sequencefor coding it, the expression carrier containing said nucleotide sequence, the host cell containing said expression carrier, the preparing process of said recombinant protein vaccine, the vaccine containing said recombinant protein for preventing and treating hepatitis C, and a method for detecting the activity of specifically killing T, lymphocytes by the hepatitis C induced by said vaccine and its cell model are disclosed.

Description

field of invention [0001] The present invention relates to a field of genetic engineering, in particular to a genetically engineered recombinant protein vaccine (hereinafter sometimes referred to as "genetically engineered recombinant protein"), in particular to a recombinant protein vaccine for preventing and treating human hepatitis C virus infection; The amino acid sequence of the recombinant protein; the nucleotide sequence encoding the recombinant protein vaccine (hereinafter sometimes referred to as "gene"); the expression vector containing the nucleotide sequence; the host cell containing the expression vector, and the The preparation method of the recombinant protein vaccine; the present invention also relates to the application of the genetic engineering recombinant protein in the preparation of vaccine products for preventing and treating human hepatitis C virus infection and the vaccine product containing the genetic engineering recombinant protein; The invention di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/29A61P1/16A61P31/12C07K14/085C12N15/11C12N15/63C12N15/64
Inventor 王丽颖孙蒙于永利
Owner BEIJING HYDVAX BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com