Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant protein vaccine for preventing and treating human prostata cancer

A recombinant protein, prostate-specific technology, applied in the field of recombinant protein vaccines for the prevention and treatment of human prostate cancer, in the field of genes encoding these two vaccines, which can solve problems such as the inability to effectively activate CTL and the inability to produce tumor preventive and therapeutic effects.

Inactive Publication Date: 2002-08-07
BEIJING HYDVAX BIOTECH
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After the exogenous protein tumor antigen is immunized to the human body, it is usually taken up and processed by the antigen-presenting cells, enters the MHC class II presentation pathway, and stimulates the humoral immune response (Heikema A, Agsteribbe E, Wilschut J, Huckriede A. Generation of heat shock protein-based vaccines by intracellular loading of gp96 with antigenic peptides. Immunol Lett 1997 Jun 1; 57(1-3): 69-74), but can not effectively activate the production of tumor-specific CTL, thus can not produce effective tumor Preventive and therapeutic effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Obtaining the encoding gene of Mycobacterium tuberculosis 65KD heat shock protein (BCG HSP65)

[0018] BCG Mycobacterium tuberculosis was obtained from Changchun Institute of Biological Products. BCG Mycobacterium tuberculosis was cultured in Sutong potato medium at a temperature of 37-39°C. The bacterial membrane was collected, and the genomic DNA of BCG Mycobacterium tuberculosis was extracted from it.

[0019] The method for extracting the genomic DNA of Mycobacterium tuberculosis refers to Molecular Cloning (J. Sambrook, Isolation of high-molecular-weight DNA from mammalian cells, 9.16-9.22, Cold Spring Harbor Laboratory Press, Molecular cloning, 1989).

[0020] The heat shock protein 65 (HSP65) structural gene was isolated from Mycobacterium tuberculosis by PCR. The 5'-end primer sequence used was 5'CCATG GCC AAG ACA ATT GCG3' (SEQ ID NO: 9), and the 3'-end primer sequence was 5' GAAATCCATGCCACCCAT3' (SEQ ID NO: 10).

[0021] The PCR operation procedur...

Embodiment 2

[0024] Example 2 Construction of BCG heat shock protein 65 human prostate specific antigen cytotoxic T lymphocyte multi-epitope single-copy polypeptide fusion protein gene

[0025] The fusion gene of HSP-65 and the CTL cell epitope of prostate specific antigen (PSA) was synthesized by PCR method. The sequence of the primer at the 5' end is: 5'CCATG GCC AAGACA ATF GCG3' (SEQ ID NO: 11), and the sequence of the primer at the 3' end is: 5'AAGCTTTTTAGTAACTTTCTGCGGGTGAACCTGAGCGCAAACGTCGTTAGAGATAACGTG CAGGTCAACGCACTGCAGTTTTTTCGGAGTCAG GAA GAA ATC CAT GCC ACC CAT GTC 3' (SEQ ID NO. NO: 12). The reaction conditions were: 94°C, 30"; 55°C, 1'; 72°C, 2', after 30 cycles, 72C extension for 10 minutes.

[0026] The PCR product was digested with NcoI and HindIII at 37°C for 2 hours.

[0027] Digestion products were separated by agarose gel electrophoresis. The conditions of electrophoresis are: 1% agarose gel, 1(TAE buffer, 150-200mA, electrophoresis for 0.5-1 hour. 20(TAE buffer: 0.8mol...

Embodiment 3

[0036] Gene sequencing of BCG heat shock protein 65 human prostate specific antigen cytotoxic T lymphocyte multi-epitope single-copy polypeptide fusion protein (using dideoxy end termination method, see the literature for specific methods: Yu Yongli, Ma Tonghui, Yang Guizhen.TA Cloning and double-stranded DNA sequencing: Introduce a method for rapid cloning and analysis of PCR products. Chinese Journal of Immunology, 1994, 10(1): 5) The results show that the obtained BCG heat shock protein 65 human prostate specific antigen cells The gene and design of the multi-epitope single-copy polypeptide fusion protein of toxic T lymphocytes are identical. Example 3 Construction of human prostate specific antigen cytotoxic T lymphocyte poly-epitope double-copy fusion protein vaccine gene containing EcoR1 cut point and Bgl II cut point Human prostate specific antigen cytotoxic T lymphocyte poly-epitope single-copy gene Construct:

[0037] The 5' specific primer [5'GCCGAGAATTCGAGCCTGAAGAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The recombinant protein vaccine is a fusion protein formed from connection of BCG vaccine heat shock protein 65 with 1-5 copies of human prostatic specific antigen cytotoxin T lymphocyte polyepitope,in which the single-copy polypeptide of said human prostatic specific antigen cytotoxin T lymphocyte polyepitope possesses amino acid sequence showed by SEQ ID NO:2, and the double single-copy polypeptide of the human prostatic specific antigen dcytotoxin T lymphocyte polyeptope possesses amino acid sequence showed by SEQ ID NO:4. After it is applied in human body, it can effectively prevent and cure carcinoma of prostate. Said invention also provides the gene for coding said two kinds of recombinant protein vaccines.

Description

Field of Invention [0001] The invention relates to a genetic engineering recombinant protein vaccine, in particular to a recombinant protein vaccine for preventing and treating human prostate cancer. The present invention also relates to the genes encoding these two vaccines. Background of the Invention [0002] Traditional prostate cancer treatment methods include surgery, radiation therapy, chemotherapy, hormone therapy, etc., but these methods have their own limitations. [0003] Human prostate specific antigen (Prostate specific antigen, PSA) is a specific antigen expressed in prostate cancer cells, and some work has been done on the development of PSA vaccines for the treatment and prevention of human prostate cancer. For example, the PSA gene was cloned into a mammalian cell expression plasmid to make a nucleic acid vaccine. This vaccine can induce humoral and cellular immunity against PSA in mice (Kim JJ et al. Molecular and immunological analysis of genetic prostate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/17A61K39/04C12N15/31
Inventor 王丽颖李大鹏于永利
Owner BEIJING HYDVAX BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com