Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Classical swine fever virus detection method based on G4-ThT biosensor and NASBA and kit thereof

A biosensor, swine fever virus technology, applied in the field of genetic engineering, can solve the problems of high cost and expensive

Pending Publication Date: 2022-08-09
SOUTH CENTRAL UNIVERSITY FOR NATIONALITIES
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Chinese invention patent "CN104611462A-a detection method and kit for swine fever virus based on G-quadruplex fluorescence characteristics" discloses related methods for detecting swine fever virus based on G-quadruplex fluorescence characteristics, but the method Expensive fluorophore-labeled probes are required in the G-quadruplex fluorescence detection reaction buffer, and the cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Classical swine fever virus detection method based on G4-ThT biosensor and NASBA and kit thereof
  • Classical swine fever virus detection method based on G4-ThT biosensor and NASBA and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0020] 1. Preparation kit, which consists of:

[0021] (1) NASBA reaction buffer includes: 50mM Tris / HCl pH8.5, 10mM MgCl 2 , 90 mM KCl, 10 mM DTT, 1 mM each dNTP, 2 mM each NTP, 10% (v / v) DMSO;

[0022] (2) NASBA forward primer and reverse primer, including: 0.4 μM forward primer E2F-GG29: CCCCTACCTCCCGCCCCTACCCGTCCCCC-CACCACCTGGAAAGAA; 0.4 μM reverse primer E2R-T7: AATTCTAATACGACTCACTATAGGGAGATACCTCCTACTGACCA; wherein the front end of the forward primer contains G-quadruplex sequence The reverse complementary sequence of GG29 is CCCCTACCTCCCGCCCCTACCCGTCCCCC and the CSFV-E2 binding sequence CACCACCTGGAAAGAA. The front end of the reverse primer is added with the T7 promoter sequence AATTCTAATACGACTCACTATAGGGAGA and the CSFV-E2 binding sequence TACCTCCTACTGACCA;

[0023] (3) NASBA enzyme reaction solution, including: 4mM DTT, 2μg BSA, 30U T7 RNA polymerase (Thermo Scientific), 6U AMV-Rt (Promega), 0.1u RNase H (Thermo Scientific);

[0024] (4) G-quadruplex amplification prod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a hog cholera virus detection method and kit based on a G4-ThT biosensor and NASBA, and the specific method comprises the following steps: taking virus RNA extracted from a hog cholera virus sample as an amplification object, carrying out isothermal amplification by adopting an isothermal nucleic acid amplification technology, then adding a buffer solution containing Tris-HCl and KCl, and carrying out isothermal amplification by adopting an isothermal nucleic acid amplification technology; then thioflavin T is added to promote G-quadruplex on an amplification product to be folded and form a compound, fluorescence is detected under the excitation condition of a light source with a specific wavelength, and judgment is carried out according to the intensity of the fluorescence. The invention provides a detection method and a kit which do not need special biotin labeling or sulfydryl modification treatment probes, and the detection cost is obviously reduced.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a swine fever virus detection method based on G4-ThT biosensor and NASBA and a kit thereof. Background technique [0002] The Chinese invention patent "CN104611462A - A swine fever virus detection method and kit based on G-quadruplex fluorescence characteristics" discloses a related method for detecting swine fever virus based on G-quadruplex fluorescence characteristics, but this method In the G-quadruplex fluorescence detection reaction buffer, an expensive fluorophore-labeled probe needs to be used, and the cost is high. SUMMARY OF THE INVENTION [0003] In order to solve the above problems, the present invention provides a probe that does not require special biotin labeling or sulfhydryl modification treatment, a detection method and a kit with significantly reduced detection cost, and the technical solutions adopted are as follows: [0004] A swine fever virus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6865C12Q1/6825C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6865C12Q1/6825C12Q2531/143C12Q2521/107C12Q2521/327C12Q2563/107Y02A50/30
Inventor 王毅贾国帅徐筱萌
Owner SOUTH CENTRAL UNIVERSITY FOR NATIONALITIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com