Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and application of CRX gene deletion mutation cat mutant

A construction method and gene deletion technology, applied in the fields of biology and genetic engineering, can solve the problem of retinal degeneration model, and achieve the effect of improving the efficiency of gene editing, reducing the experimental process, and simplifying the operation process.

Pending Publication Date: 2022-05-20
QINGDAO AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The cat retinal degeneration model has no relevant research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of CRX gene deletion mutation cat mutant
  • Construction method and application of CRX gene deletion mutation cat mutant
  • Construction method and application of CRX gene deletion mutation cat mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Design, construction, in vitro transcription and verification of transgenic target vectors

[0036] sgRNA sequence design:

[0037]According to the cat CRX gene sequence information provided by the NCBI, the target site sequence 5'-TGGCGGCCGGCCCCCTCTCTGA-3' (SEQ ID NO:2) was selected based on the cat CRX gene Exon4, and the DNA sequence of the sgRNA that identified this site was 5'-gggcggggctggtggccc-3' (SEQ ID NO:9). According to the requirements of the T7 promoter in vitro transcription kit used (purchased from Vazyme), the sgRNA in vitro transcriptional sequence is designed: TAATACGACTCACTATAgggggctggtggcc GTTTAGA (SEQ ID NO:3), Design sgRNA complementary sequence: AAAAAAGCACCGACTCGGTCCACTTTCAAGTTGATAACACTACTTAACTTACTTACTT(SEQ ID NO:4), including sgRNA PCR amplification primers F:GGATCCTAATACGACTCACTATAG (SEQ ID NO:5) and sgRNA PCR amplification primer R:AAAAAAGCACCGACTCGG (SEQ ID NO:6).

[0038] sgRNA synthesis in vitro:

[0039] According to the designed sgR...

Embodiment 2

[0047] Example 2: simultaneous estrus treatment of cats and CRX gene knockout cat embryo transfer

[0048] Cat contemporal estrus regimen:

[0049] Select adult female cats (6 months of age and older) with normal posture and no disease, and determine that their last estrus period is at least 2 weeks apart from this contemporaneous estrus time. On the first day, 2-4 pm intramuscular prostaglandin 100 IU is injected for two consecutive days at an interval of 24H; on the third day, 200 IU PMSG is injected intramuscularly at 1 pm, at an interval of 74 h, 100 IU hCG is injected and the male in estrus is combined and mated naturally.

[0050] Cat special period fertilized egg acquisition protocol:

[0051] The Chinese pastoral female cat, which is treated in estrus at the same time, is used as a fertilized egg donor and as an embryo transfer receptor for experiments. After natural mating, the fertilized embryos are washed away. The M2 manipulation solution is used as the ovulation fluid...

Embodiment 3

[0061] Example 3: CRX gene knockout cat gene mutation detection

[0062] After the kitten is born, tail tissue is collected for identification. Scrape as small tissue as possible under the microscope (closer to the cell size the better) into 1 ul of PBS, then add 1 ul protease K water bath 55 °C lysis 0.5 h, 95 °C inactivation for 2 min. After lysis, the sample was cat genomic DNA.

[0063] PCR using cat genomic DNA as a template with the primers are:

[0064] Forward Primer F:5'-GCACAAACCAAGGCTCGTCC-3' (SEQ ID NO:7);

[0065] Reverse primer R:5'-GATCCAGGCCAVTGAAATAGGAG-3'(SEQ ID NO:8),

[0066] Amplification sgRNA recognition cleaves DNA fragments totaling 331 bp upstream and downstream of the target. The PCR amplification of the fragment of interest was sequenced for DNA sequencing, and the cat CRX gene sequence provided by the NCBI database was compared to determine the mutation type of the CRX gene.

[0067] After sequencing and sequence information comparison, 2 male cats in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method of a CRX (Clustered Regularly X) gene deletion mutation cat mutant, which comprises the step of knocking out partial sequences of one or more exon sequences of a wild CRX gene of a cat to ensure that the CRX gene cannot be normally expressed. According to the obtained CRX gene knockout cat, a disease animal model with huge application value is provided for medical research, and a foundation is laid for promoting research of hereditary eye diseases and screening of eye disease drugs.

Description

Technical field [0001] The present invention relates to the field of biotechnology, specifically to the field of genetic engineering technology, and in particular to a method of constructing a cat mutant with a CRX gene deletion type mutation. Background [0002] Retinal degeneration is a degenerative disease of vision caused by environmental, genetic and other factors. The causes of retinal degeneration are complex, and their pathogenesis is related to a variety of factors. The CRX gene is a member of the OTD / OTX homologous domain protein family, which is a member of the transcription photoreceptor transcription factor network necessary for mammalian eye development, controlling the expression, development, and maintenance of photoreceptor genes. Development, maturation and continued survival of rod- and cone-shaped photoreceptors are essential. Degenerative disease of the retina associated with the CRX gene is dominantly hereditary, and occurs most often in childhood, resulting...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89A01K67/027A61K49/00
CPCC12N15/89A01K67/0276C07K14/47A61K49/0008A01K2227/10A01K2267/03
Inventor 赵明辉李惠由荣静王宁
Owner QINGDAO AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com