Application of Candidatus Liberibacter asiaticum effector as target for screening anti-Candidatus Liberibacter asiaticum drugs
A technology of citrus huanglongbing bacteria and citrus huanglongbing, which is applied in the field of microorganisms to achieve the effects of small genome, simple cultivation, and stable genetic operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Construction of Yeast Expression Strain Containing CLa1305 Effector
[0041] 1. PCR amplification of the target fragment
[0042] The citrus huanglongbing Asian strain psy62 genomic DNA was used as a template to amplify the fragment of CLIBASIA——01305 gene (CLa1305, encoding the P-ring protein of the flagellar substrate GenBank: ACT56849.1), and the reaction system is shown in Table 1, wherein the upstream primer F : CTTGGTACCGAGCTCGGATCCATGATTTTTCGTATAGCTTTTTTGATTTTTTC, downstream primer R: TGCTGGATATCTGCAGAATTCTTGAATTATAATCTCTGATTGAAGGGCGCCCG,.
[0043] Table 1 PCR reaction system:
[0044]
[0045] The PCR amplification conditions were: 95°C pre-denaturation for 2 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 3 min, a total of 30 cycles, 72°C extension for 5 min, and 12°C storage.
[0046] 2. Connection conversion
[0047] After the PCR reaction, the PCR product was detected by 1% agarose gel electrophoresis, purified an...
Embodiment 2
[0050] Example 2 Detection of Effects of CLa1305 Effectors on Saccharomyces cerevisiae Cell Growth Phenotype
[0051] 1. Experimental method
[0052] The yeast strain p-1305 prepared in Example 1 was taken out from -80°C, as well as the positive control strain p-exoY (expressing the toxin ExoY secreted by the Pseudomonas aeruginosa type III secretion system) and the negative control strain carrying the pYES3 empty vector, respectively. Streak activation on tryptophan-deficient plate SD-T plate, culture at 30°C for 2 days, take a single colony and culture in 3ml SD-T liquid medium overnight at 30°C. Take 2ml of overnight culture bacteria solution, wash twice with double distilled water, and adjust the OD600 of the bacteria solution to 1.0. Dilute 5 times with a gradient of 10, take 15 μl and spot on SD Trp inhibition medium and SC-Trp induction medium respectively, culture at 30°C for 2 to 3 days, observe the growth status, and take pictures for records.
[0053] 2. Experimen...
Embodiment 3
[0055] Example 3 Determination of the Effect of Expression of CLa1305 Effector on Yeast Cell Viability
[0056] 1. Experimental method
[0057] Yeast single colonies p-1305 and pYES3 prepared in Example 1 carrying the candidate effector CLa1305 and the empty plasmid were cultured overnight in 3 ml of suppression medium SD-T, 30° C., 250 rpm. Take the overnight culture solution at 10,000 rpm, centrifuge for 3 minutes to remove the supernatant, resuspend with fresh SD-T medium, and adjust the OD600 to 0.5. After continuing to culture for 2 hours, centrifuge at 10,000 rpm for 3 minutes to remove the supernatant, resuspend with SC-T medium, adjust OD600 to 0.2, and culture at 30°C for 55 hours. Select ten time periods and take equal amount of culture solution to dilute and plate on SD-T solid medium, serially dilute 5 gradients 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 , each group had 3 replicates, took 100 μl of bacterial solution to plate, and counted single colonies after cultur...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com