Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A fusion protein, recombinant vector, recombinant dendritic cell and application thereof for transmembrane expression of novel coronavirus antigen s2

A coronavirus and fusion protein technology, applied in the field of whole-cell vaccines, can solve problems such as virus infection, achieve strong immunogenicity, high degree of conservation, and prevent virus invasion

Active Publication Date: 2021-07-13
GENERAL HOSPITAL OF PLA +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using the full-length protein of the virus as an antigen for clinical use can cause a partial preventive effect on the virus, but it is also common to see clinical reports of antibody-dependent enhancement (Antibody-dependent enhancement, referred to as ADE), which may produce a more effective antiviral effect than before. More severe viral infections in vaccine recipients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fusion protein, recombinant vector, recombinant dendritic cell and application thereof for transmembrane expression of novel coronavirus antigen s2
  • A fusion protein, recombinant vector, recombinant dendritic cell and application thereof for transmembrane expression of novel coronavirus antigen s2
  • A fusion protein, recombinant vector, recombinant dendritic cell and application thereof for transmembrane expression of novel coronavirus antigen s2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Plasmid construction:

[0057] Gene synthesis of the fusion gene CD4 signal peptide-S2 protein-flag tag-CD4 transmembrane domain (entrusted to Jinweizhi Biotechnology Co., Ltd.), the specific sequence is:

[0058] atgaaccggggagtcccttttaggcacttgcttctggtgctgcaactggcgctcctcccagcagccactcagggaagctttatcgaggacctgctgttcaacaaggtgaccctggccgatgccggcttcatcaagcagtatggcgattgcctgggcgacatcgcagccagggacctgatctgcgcccagaagtttaatggcctgaccgtgctgccacccctgctgacagatgagatgatcgcacagtacacaagcgccctgctggccggcaccatcacatccggatggaccttcggcgcaggagccgccctccagatcccctttgccatgcagatggcctataggttcaacggcatcggcgtgacccagaatgtgctgtacgagaaccagaagctgatcgccaatcagtttaactccgccatcggcaagatccaggacagcctgtcctctacagccagcgccctgggcaagctccaggatgtggtgaatcagaacgcccaggccctgaataccctggtgaagcagctgagcagcaacttcggcgccatctctagcgtgctgaatgacatcctgagccggctggacaaggtggaggcagaggtgcagatcgaccggctgatcaccggccggctccagagcctccagacctatgtgacacagcagctgatcagggccgccgagatcagggccagcgccaatctggcagcaaccaagatgtccgagtgcgtgctgggccagtctaagagagtggacttttgtggcaagggctatc...

Embodiment 2

[0090] Material:

[0091] Cells: DC cells

[0092] Medium: 1640 complete medium

[0093] ELISA antibody:

[0094] Biotinylated2019 n-Cov Spike S-His (KACTUS company)

[0095] Spike S2(SARS-Cov-2)(HEK293)(Beijing Sino Biological Technology Co., Ltd.)

[0096] GoaAnti-Mouse IgG-HRP (1:10000)

[0097] Mice: female Balb / c mice (5 weeks, about 25g)

[0098] method:

[0099] Take DC-pCDH-K-S2-CD4, DC-PCDH-K-S2, DC-PCDH-K-S and other three kinds of cells each 1×10 8 cell, and then resuspend the cells with 1ml of PBS.

[0100] Animal experiments were divided into six groups: ①PBS group, ②DC-S2-CD4 group, ③DC-PCDH-K-S2 group, ④DC-PCDH-K-S group, 4 mice in each group, each mouse was injected with 2×10 7 cells.

[0101] After 14 days, take 200 μl of blood from each mouse to separate serum: place the collected serum in a 37°C incubator for 1 hour, and then centrifuge at 3000 rpm for 20 minutes. After the centrifugation, transfer the upper serum to a labeled 1.5ml centrifuge tube,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion protein, a recombinant vector, a recombinant dendritic cell and its application for transmembrane expression of novel coronavirus antigen S2, belonging to the technical field of whole cell vaccines. The fusion protein includes CD4 signal peptide linked in sequence , novel coronavirus antigen S2 protein, Flag tag sequence and CD4 transmembrane domain; the present invention expresses S2 alone across the membrane, avoiding the risk of ADE that may be caused by other S protein epitopes, and the fusion protein construction provided by the present invention The cellular vaccine can induce higher neutralizing antibody titers in mice.

Description

technical field [0001] The invention belongs to the technical field of whole cell vaccines, and in particular relates to a fusion protein expressing novel coronavirus antigen S2 across membranes, a recombinant vector, recombinant dendritic cells and applications thereof. Background technique [0002] Novel coronavirus (2019-nCoV, SARS-CoV-2) is a type of coronavirus of the genus β. Infection with the virus can cause symptoms such as fever, dry cough, and fatigue in patients; some patients will develop severe pneumonia, and then develop Acute respiratory distress syndrome, septic shock, coagulation dysfunction, multiple organ failure, etc., and even death. The SARS-CoV-2 virus adsorbs and enters host cells through the envelope protein on its surface, thereby infecting human respiratory epithelial cells and alveolar cells. The envelope protein of SARS-CoV-2, Spike protein (S), is a glycoprotein that mainly functions in cell adhesion and cell membrane fusion. [0003] The S p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/85C12N5/10A61K39/215A61P31/14
CPCA61K39/12A61K2039/5154A61P31/14C07K14/005C07K2319/02C07K2319/03C07K2319/43C12N5/0639C12N15/85C12N2510/00C12N2770/20022C12N2770/20034C12N2800/107
Inventor 焦顺昌陈静远汪坤福袁翰张艳玲李斯慧冯向辉宋文静吕鹏敏钟宏东胡坤
Owner GENERAL HOSPITAL OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com