Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific human gene fragment and primer probe and application thereof

A gene fragment, primer probe technology, applied in the field of molecular biological detection, can solve the problems of inability to specifically detect a variety of animal and human genes, lack of specificity of target genes, and inability to directly correspond to cell volume, etc., to reduce costs and operation. Simple, time-saving effects

Inactive Publication Date: 2021-02-05
北京昭衍新药研究中心股份有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no standard human-derived specific gene detection scheme, and the commonly used detection methods mainly have the following defects: 1) The primer probe and the target gene for detection are not specific enough to specifically detect human-derived genes in various animals. Gene
2) Due to the interference of animal background DNA, when the content of human genes in animals is small, accurate quantification cannot be achieved
3) The commonly used human-specific gene Alu is a rich short scattered repeat sequence unique to the primate genome, which is difficult to distinguish between humans and non-human primates; at the same time, there are multiple copies of the Alu gene in the genome , and the copy number is slightly different between different parts and different races, the determined copy number results cannot directly correspond to the cell mass
[0006] In the prior art, scholars have conducted research on FOXP2. Studies have shown that FOXP2 protein can regulate the development of the lung and esophagus, regulate the proliferation and function of α-islet cells, regulate the growth of osteosarcoma cells, and inhibit gastric cancer, liver cancer, and breast cancer. and other cancers, but FOXP2 has not been applied to the detection of human cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific human gene fragment and primer probe and application thereof
  • Specific human gene fragment and primer probe and application thereof
  • Specific human gene fragment and primer probe and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Human Gene Detection Kit

[0049] 1. Human cell-specific gene fragments: through the NCBI website and its BLAST sequence comparison function, determine the species specificity of the FOXP2 gene, and select the fragment with the highest specificity as the specific gene for the quantitative detection of human cell in the present invention fragment.

[0050] Specific gene fragment sequence of human cells (SEQID NO: 1):

[0051] TGCTATGTGATGGACATGGTTCTGTTTTAGTATTCATTGCATTTATAAGTACCAATATGCCAGAGTGGTAGTCTGGAACACCGTAAGAGTACTGGTGGGCTAAAAGGAAGAAAGAGGTCAAAAAGATAGATGGGGTACCTAAAGCCTGCCATATGTTTTCATCACT.

[0052] 2. Design specific primers and probes according to the specific gene fragment sequence of human cells, the sequence is as follows:

[0053] homo4-F (SEQ ID NO: 2): 5'-TGGTAGTCTGGAACACCGTAAGAGT-3';

[0054] homo4-R (SEQ ID NO: 3): 5'-CATATGGCAGGCTTTAGGTACCC-3';

[0055] homo4-P (SEQ ID NO: 4):

[0056] FAM-CTGGTGGGCTAAAAGGAAGAAAGAGGTC-TRAMA.

[0057] The primer...

Embodiment 2

[0058] Example 2 Standard plasmid construction

[0059] 1. Acquisition of human cell-specific gene fragments

[0060] Genomic DNA in human whole blood was extracted using a commercial genome extraction kit (blood / tissue / cell genomic DNA extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. DP304), and used as amplified human cell-specific gene fragment Added templates. Prepare the reaction system as follows:

[0061] Table 1 PCR reaction system

[0062] Reagent name Volume (μL) template 5 homo4-PF1 1 homo4-PR1 1 Premix Ex Taq Hot Start Version 10 Deionized water to 20

[0063] Among them, the primer homo4-PF1 (SEQ ID NO: 5): 5'-TGCTATGTGATGGACATGGTTCT-3'; homo4-PR1 (SEQ ID NO: 6): 5'-AGTGATGAAAACATATGGCAGGC-3'.

[0064] Reaction conditions: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 20 sec, renaturation at 55°C for 20 sec, extension at 72°C for 1 min, 30 cycles; final extension at 72°C ...

Embodiment 3

[0085] Embodiment 3 qPCR method and sample detection

[0086] Take the method validation of detecting stem cells in preclinical mouse tissues and whole blood and the mouse tissue distribution test of stem cell drugs as examples:

[0087] 1. Tissue sample collection: Collect whole blood, liver, kidney, spleen, heart, lung and other tissues according to the animal test plan, each tissue is collected at 30-50 mg / part, and then stored in an ultra-low temperature refrigerator for later use.

[0088] 2. Nucleic acid extraction: Genomic DNA was extracted using a commercially available tissue / whole blood genomic DNA extraction kit (blood / cell / tissue genomic DNA extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304). To measure the DNA concentration with a microplate reader, the OD260 / OD280 ratio of the extracted nucleic acid is required to be between 1.6 and 1.9, and the sample with high DNA concentration is diluted to below 0.4 μg / μL with TE Buffer for determinati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a human cell specific gene fragment, a specific primer and a probe thereof, and a method for specific quantitative detection of a human gene. According to the invention, throughthe NCBI website and a BLAST sequence comparison function of the NCBI website, a human specific gene fragment with a length of 166 bp on FOXP2 gene is obtained, and human genes in tissues, blood andother non-human samples of various preclinical animals are quantified by qPCR. The human cell specific gene fragment and qPCR quantitative detection method adopted by the invention are high in specificity, strong in sensitivity, good in repeatability and simpler and more convenient to operate, and provide a new thought and a corresponding technical support for quantitative detection of specific human genes.

Description

technical field [0001] The invention relates to the technical field of molecular biological detection, in particular to a specific human gene fragment, primers, probes and applications thereof. Background technique [0002] In recent years, the administration of cell therapy drugs such as mesenchymal stem cells, hematopoietic stem cells, embryonic stem cells, and immune cells has become a research hotspot in the fields of tumors, diabetes, and various organ function declines, and many innovative drugs have entered the clinical trial stage , showing great application potential of cell therapy drugs. At present, many cell therapy drugs are still in the preclinical research stage, and there is still a lack of sufficient understanding of the distribution, metabolism, and colonization and differentiation of stem cells in vivo after cell drugs enter the body. The distribution and metabolism of cellular drugs in the body have a direct impact on their efficacy, so preclinical pharm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12N15/11C12N15/70C12N1/21C12R1/19
CPCC07K14/4702C12N15/70C12Q1/6851C12Q2531/113C12Q2563/107C12Q2545/114
Inventor 汪宁李洪贞杨欢杨梅
Owner 北京昭衍新药研究中心股份有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More