Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 (fibroblast growth factor receptor 2) gene

A technology of nucleic acid composition and gene fusion, applied in biochemical equipment and methods, recombinant DNA technology, measurement/testing of microorganisms, etc., can solve problems such as rapid detection of gene fusion mutations, and achieve the effect of reducing the number of detections

Active Publication Date: 2020-12-29
江苏申基生物科技有限公司
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Real-time fluorescent quantitative PCR method cannot be used for rapid detection in view of the existing technology FGFR2 For the problem of gene fusion mutation, the application provides a method for detecting human FGFR2 Nucleic acid composition, kit and detection method for gene fusion mutation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 (fibroblast growth factor receptor 2) gene
  • Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 (fibroblast growth factor receptor 2) gene
  • Nucleic acid composition, kit and detection method for detecting fusion mutation of human FGFR2 (fibroblast growth factor receptor 2) gene

Examples

Experimental program
Comparison scheme
Effect test

preparation example

[0071] contain FGFR2 Preparation of positive control plasmid for gene fusion mutation

[0072] (1) 18 containing FGFR2 The gene of the gene fusion mutation site was connected with the pcDNA3.1 (+) plasmid, and 18 containing FGFR2 Plasmids for gene fusion mutations. The 18 contain FGFR2 The gene sequence of the gene fusion mutation site is as follows (in the following sequence, the unlined part indicates one gene, and the underlined part indicates another gene):

[0073] FGFR2(17)_BICC1(3) SEQ ID NO. 24

[0074] TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAG ATCATGGAGGAAACAAATAC GCAGAT...

Embodiment 1

[0112] Design synthetic primers and probes for mutation sites

[0113] According to NCBI published persons FGFR2 Gene sequence and fusion partner gene sequence (wild-type sequence), for FGFR2 Gene 18 fusion mutations were used to design specific primers and probes. And through the optimization of specific primer and probe system, high sensitivity and specific detection can be achieved, FGFR2 The 18 fusion mutation sites of the gene are shown in Table 1.

[0114] Table 1 FGFR2 Gene Fusion Detection Site

[0115]

[0116] For the selected 18 fusion mutation sites, multiple pairs of specific primers and probes were designed using Oligo 7.0 primer design software. The sequences of primers and probes are shown in Table 2.

[0117] The 5' end of the probe sequence designed in this application is modified with a fluorescent reporter group, and the 3' end of the probe sequence is modified with a fluorescent quencher group. Preferably, the fluorescent reporter group of the tar...

Embodiment 2

[0125] one for detecting people FGFR2 Kit for gene fusion mutation, including primer probe, Taq enzyme, 10×PCR Buffer, dNTPs, MgCl in Example 1 2 and PCR enhancers.

[0126] The final concentration of each reagent in the above kit in the final reaction amplification system is shown in Table 3:

[0127] Table 3 The final concentration of each component in the reaction amplification system

[0128]

[0129] Specifically, taking the 25 μL reaction system as an example, the specific addition amount of each component in the above kit is shown in Table 4:

[0130] Table 4 The amount of each component added in the real-time fluorescent quantitative PCR reaction system

[0131]

[0132] The PCR reaction conditions using the above reaction system are as follows: pre-denaturation at 95°C for 5 minutes, 1 cycle; denaturation at 95°C for 25 seconds, annealing at 64°C for 20 seconds, extension at 72°C for 20 seconds, 15 cycles; denaturation at 93°C for 25 seconds, 60 ℃ annealing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid composition, kit and detection method for detecting fusion mutation of a human FGFR2 (fibroblast growth factor receptor 2) gene. The nucleic acid composition comprises primers and probes designed for 18 fusion mutation types of the FGFR2 gene. The kit comprises the nucleic acid composition, and also comprises DNA polymerase, a PCR buffer solution, dNTPs and cations. The invention also provides a method for detecting fusion mutation of the FGFR2 gene. The method comprises the following steps: firstly, extracting RNA of a detection sample, carrying out reverse transcription to obtain cDNA, carrying out real-time fluorescent PCR reaction by using the kit with the cDNA as a template, and finally judging the negative and positive properties of the detection sample according to a Ct value. The kit can be used for simultaneously and specifically detecting 18 fusion mutations of the FGFR2 gene, is wide in mutation site coverage range, reduces the detection times, and has the advantages of high sensitivity, good repeatability, simplicity and convenience in operation, high detection speed, easiness in result interpretation and the like.

Description

technical field [0001] The present application relates to the technical field of in vitro molecular diagnosis, in particular to a nucleic acid composition, kit and detection method for detecting fusion mutations of the human FGFR2 gene. Background technique [0002] Cholangiocarcinoma (CCA) is a highly heterogeneous malignant tumor originating from bile duct epithelial cells, accounting for about 3% of all gastrointestinal malignancies, and is the second most common hepatobiliary malignancy after liver cancer. In my country, the incidence and mortality of cholangiocarcinoma are increasing year by year. Cholangiocarcinoma is highly malignant and progresses rapidly. Radical surgery is currently the only effective cure. However, most patients (65%) are diagnosed at an advanced stage and lose the chance of surgical resection. They are prone to recurrence after surgery, and the prognosis is extremely poor. . For patients with unresectable or metastatic CCA, gemcitabine combined...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6886C12Q2600/156C12Q2600/16C12Q2600/166C12Q2521/101C12Q2531/113C12Q2545/101C12Q2563/107C12Q2537/143
Inventor 丁晓麟张硕肖潇黄磊童坤
Owner 江苏申基生物科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More