Method for infecting porcine small intestinal mucosa epithelial cell line with porcine epidemic diarrhea virus
A technology of porcine epidemic diarrhea and epithelial cells, applied in the direction of gastrointestinal cells, epidermal cells/skin cells, viruses, etc., can solve problems such as damage to suckling piglets, economic losses in the pig industry, and difficulties in the epithelial cell line of the small intestinal mucosa of pigs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Method for Infecting Porcine Small Intestinal Epithelial Cell Line with Porcine Epidemic Diarrhea Virus
[0040] 1.1 Use a bottom area of 25cm 2 The IEC cell line was cultured in the cell flask, and the volume of the culture medium in the culture was 5 mL. When the cells were covered with a single layer, the culture medium was discarded. Second-rate. Add 1 mL of porcine epidemic diarrhea virus solution containing trypsin 10 μg / mL to each bottle, and place at 37 °C in 5% CO 2 Adsorption in the incubator for 90min. After the adsorption is completed, the liquid is discarded, and DMEM liquid medium containing 5 μg / mL trypsin is added for cultivation and observation. Cytopathy appeared at 36h. It can be seen that the cells fall off and become round, and the intercellular space becomes larger, realizing the in vitro cultivation of porcine epidemic diarrhea virus. The collected cell cultures were repeatedly frozen and thawed three times in a -80°C refrigerator to pre...
Embodiment 2
[0063] Real-time fluorescent quantitative detection of the virus copy number of the original virus liquid and the copy number of the 50th generation virus liquid in Example 1, and the RNA was extracted by a conventional extraction method for extracting viral RNA.
[0064] The cDNA after RNA reverse transcription was subjected to PCR reaction to amplify the S gene, (SEQ ID No. 3) upstream primer F: GCAGATTTAGAGCAGCGTTCA, (SEQ ID No. 4) downstream primer R: TAATCAACCAAACCCACCAC.
[0065] The amplification system is as follows: cDNA 2 μL, SYBR GreenMix 10 μL, upstream primer 0.4 μL, downstream primer 0.4 μL, add deionized water to 20 μL, and mix well. The primer concentration was 10 μM.
[0066] The PCR amplification program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 10 s, annealing at 61.3°C for 30 s, extension at 72°C for 30 s, and 40 cycles.
[0067] Through the fluorescent quantitative PCR detection method established in the laboratory, the...
PUM
Property | Measurement | Unit |
---|---|---|
Copy number | aaaaa | aaaaa |
Copy number | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com