Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of wx mutant protein and its gene in plant breeding based on gene editing technology

A mutant, protein technology, applied in applications, plant products, genetic engineering, etc., can solve the problems of difficulty in meeting the urgent needs of high-quality soft fragrant rice varieties, multiple genetic mutations in wild-type materials, and poor appearance and quality of rice, and achieve improvement. Effects of palatability and eating quality, improved breeding efficiency, and appropriate BDV elevation values

Active Publication Date: 2022-07-29
JIANGSU ACAD OF AGRI SCI +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For quality traits, backcrossing is a commonly used method. Generally, 4-6 generations of backcrossing are required, and at least 3-5 generations are required for homozygous selfing. To improve a single trait and play a role in production, at least 6-8 years, the breeding cycle is long, it is difficult to meet the urgent needs of the market and the people for high-quality soft fragrant rice varieties
If we want to tap new soft rice genetic resources, we mainly rely on chemical mutagenesis at present. As we all know, the frequency of chemical mutations is low, and the initial investment is large. It may take 2-3 years to screen and obtain a stable material. At the same time, chemical mutagenesis may cause wild There are multiple gene mutations in the type material, and it needs to be improved through hybridization to eliminate bad gene mutations when it is applied to production
[0007] 2. Most soft rice japonica rice varieties have poor appearance quality
For single-base mutations, enzyme-cut target markers can be designed, but the process is relatively cumbersome. Allele-specific PCR is developed, and genotypes with high and low amylose content can be distinguished by two PCRs
[0013] At present, if scientific and technical personnel want to obtain new materials or new genes of soft rice with AC reduced to 8-12% and the appearance remains transparent, they need to undergo chemical or radiation mutagenesis, which requires a lot of work and the effect is not ideal.
Simultaneously, adopt conventional chemical mutagenesis and conventional transgenic breeding, its breeding life will be at least 6-8 years, and the breeding cycle is long, be difficult to satisfy the urgent demand of market and common people to high-quality soft fragrant rice variety
[0014] At the same time, there is no relevant report on the use of gene editing technology to perform site-directed mutations on the Wx gene of rice varieties to create new soft rice alleles

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of wx mutant protein and its gene in plant breeding based on gene editing technology
  • Application of wx mutant protein and its gene in plant breeding based on gene editing technology
  • Application of wx mutant protein and its gene in plant breeding based on gene editing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1: Obtainment of Genetically Transformed Plants

[0079] 1. Suken 118Wx gene cloning and target site design

[0080] With reference to the CTAB method of Murray et al., the genomic DNA of Suken 118 was extracted (Murray MG, et al., Nucleic Acids Research, 1980, 8(19): 4321-4326). The genomic DNA was amplified by PCR with primers Wx-F: CCCTAGCCACCCAAGAAA (SEQ ID NO: 5), Wx-R: CACCCAGAAGAGTACAACATCA (SEQ ID NO: 6), and the amplified product was sent to Yingweijieji (Shanghai) Trading Co., Ltd. The company conducts sequencing. The sequencing results were compared in the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) database for Blast analysis, and it was found that the sequence of the Wx gene coding region of Suken 118 was the same as that of the reference genome rice Nipponbare.

[0081] According to the Wx gene sequence of Suken 118, the CRISPR-GE website (http: / / skl.scau.edu.cn / targetdesign / ) predicted that the target site wxb#9 was designed on exon 4: CGACT...

Embodiment 2

[0114] Example 2: Knockout of mutant exogenous DNA (T-DNA), re-identification of genotype and screening of homozygous plants

[0115] The pH-nCas9-PBE-wxb#9 and pH-nCas9-PBE-wxb#24 vectors constructed by the present invention for directional and precise single-base editing of the Wx gene are both binary T-DNA vectors, and the T-DNA involved in the present invention is mainly It contains the hygromycin phosphotransferase HPT gene and the nCas9 nuclease gene. For the rice genome, these two genes, as the representative exogenous DNA, need to be deleted for the following reasons: 1) The hygromycin phosphotransferase HPT gene is mainly The function is to serve as a selection marker in the process of genetic transformation, and the corresponding encoded hygromycin protein is a class of antibiotics; 2) The main function of the nCas9 gene is to complete the site-directed cleavage of the target site of the target gene, and its continued retention in the plant may cause Secondary editin...

Embodiment 3

[0121] Example 3 Phenotypic analysis of mutants

[0122] Eating and Cooking Quality (ECQ) is a direct factor affecting consumers' choice, so it is the most important evaluation index in the composition of rice quality. Although my country has promulgated the national standard "Rice Cooking and Edible Quality Sensory Evaluation Method" (GB / T15682-2008), due to the inability to completely exclude the influence of subjective factors, the method of manual tasting still cannot accurately identify the quality of rice. Since starch is the main component of rice endosperm, the composition and structure of starch are the most important factors affecting rice ECQ. This example utilizes the 4 Ts obtained in Example 2 2 Generation of seeds of T-DNA knockout homozygous mutants 118-1-1, 118-3-2, 118-5-1 and 118-9-15 (T 3 Substitute) for the determination of some physical and chemical indicators of starch, so as to objectively evaluate the rice ECQ.

[0123] 1. Determination of amylose co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice Wx mutant protein, a mutant gene and applications thereof. The invention also discloses a breeding method for using gene editing to create quality-improved rice with transparent appearance and appropriately reduced amylose content. The present invention uses gene editing technology for the first time to wx Gene undergoes single base editing, through progeny screening, in T 2 A new material with T-DNA removed, transparent appearance, appropriately reduced amylose content, improved quality, and stable inheritance can be obtained. Compared with breeding such as chemical mutagenesis and hybridization, gene editing-directed molecular breeding technology has the advantages of rapidity, precision, and efficiency. It can be combined with gene function marker genotype selection, or directly use other mature rice varieties as background materials for transformation and acquisition. The corresponding materials will greatly improve the breeding efficiency and greatly speed up the breeding process.

Description

technical field [0001] The invention belongs to the fields of crop genetic breeding, new resource innovation for crop quality improvement, and excellent edible crop breeding, and particularly relates to the application of a Wx mutant protein and its gene based on gene editing technology in plant breeding. Background technique [0002] Rice (Oryza sativa L.) is an important food crop in China and even in the world, and plays a pivotal role in ensuring food security. [0003] Rice quality refers to the basic characteristics that rice must have in commodity circulation, including four main aspects: grinding quality, appearance quality, cooking and eating quality, and nutritional quality, among which appearance quality and cooking and eating quality are particularly important. Seed endosperm is the main edible part of rice. From the chemical composition analysis, the main component of endosperm is starch, which generally accounts for 90% of the dry weight of the endosperm, or ev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H6/46C12Q1/6895
CPCC12N9/1051C12Y204/01021C12N15/8245C12N15/8261
Inventor 杨杰高彩霞许扬王芳权张瑞陈智慧
Owner JIANGSU ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More