Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An adenovirus vector vaccine for the prevention of SARS-CoV-2 infection

A sars-cov-2 and vaccine technology, applied in the direction of DNA/RNA vaccination, virus/bacteriophage, double-stranded DNA virus, etc., can solve the problems of low expression, invalid vaccine titer, insufficient resistance to virus infection, etc. Achieve good safety effect

Active Publication Date: 2020-08-07
GUANGZHOU N BIOMED LTD
View PDF10 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, experiments have shown that the natural SARS-CoV-2 spike protein S gene has a low expression level in the human body. If it is expressed as an antigen with the original S codon, it is not enough to produce enough antigen, and its vaccine may be ineffective or Is the titer is very low, not enough to resist the infection of the virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An adenovirus vector vaccine for the prevention of SARS-CoV-2 infection
  • An adenovirus vector vaccine for the prevention of SARS-CoV-2 infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The amino acid sequence of the Spike protein (S) of SARS-CoV-2 is shown in YP_009724390.1, denoted as NB1.

[0038] The pre-mRNA transcribed by eukaryotic cells can produce different mRNA splicing isoforms through different splicing methods (selecting different combinations of splicing sites), which ultimately leads to different proteins produced by the same gene sequence. This is very detrimental to protein expression. The inventor optimized the codon of the wild-type natural nucleic acid sequence and removed potential variable splicing sites based on his own technology, which ensured the uniqueness of protein expression and reduced the difficulty of subsequent protein purification. The optimized nucleic acid sequence is denoted as NB2, and its specific sequence is shown in SEQ ID NO: 1:

[0039]ATGTTCGTGTTTCTGGTGCTGCTGCCTCTGGTGAGCTCCCAGTGCGTGAACCTGACCACAAGGACCCAGCTGCCACCTGCCTATACCAATAGCTTCACACGGGGCGTGTACTATCCCGACAAGGTGTTTAGATCTAGCGTGCTGCACTCCACCCAGGATCTGTTTCTGCCTTTCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an adenovirus vector vaccine for preventing SARS-CoV-2 infection. The vaccine comprises a nucleic acid sequence as shown in SEQ ID NO: 1. According to a plurality of embodiments of the invention, the S protein nucleic acid sequence contained in the vaccine is easy to express in human cells, and generation of more S proteins can be induced, so the vaccine is expected to be used as a recombinant virus vaccine for preventing SARS-CoV-2 infection. According to a plurality of embodiments of the invention, the vaccine has good security.

Description

technical field [0001] The invention relates to an adenovirus vector vaccine for preventing SARS-CoV-2 infection. Background technique [0002] The incubation period of the new coronavirus SARS-CoV-2 can be as long as 24 days, and it is highly contagious. Unlike the SARS virus that caused SARS, some cases are contagious during the incubation period, and some virus carriers do not show any obvious symptoms. This has increased the difficulty of epidemic prevention and control. Therefore, the rapid development of preventive vaccines that can increase the level of herd immunity and block the spread of the virus has become the most urgent major demand at present. [0003] For the new coronavirus, there are currently no specific proven antiviral drugs and preventive vaccines at home and abroad. Therefore, prevention and blocking the spread of the virus are the key to controlling the epidemic. The application of vaccines has played an irreplaceable role in eliminating many infec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/215A61P31/20C12N15/861
CPCA61K39/12A61K2039/5256A61K2039/53A61P31/20C12N15/86C12N2710/10343C12N2770/20034C12N2800/107
Inventor 陈凌杨臣臣刘晓琳
Owner GUANGZHOU N BIOMED LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com