Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of bacillus licheniformis without leucine dehydrogenase gene in heterologous protein production

A technology of Bacillus licheniformis and leucine dehydrogenase, applied in application, genetic engineering, plant gene improvement, etc., to achieve the effect of improving protein expression level

Active Publication Date: 2020-03-24
HUBEI UNIV
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether the expression level of this gene is related to the expression of heterologous protein has not been studied, and it is unpredictable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of bacillus licheniformis without leucine dehydrogenase gene in heterologous protein production
  • Application of bacillus licheniformis without leucine dehydrogenase gene in heterologous protein production
  • Application of bacillus licheniformis without leucine dehydrogenase gene in heterologous protein production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Obtaining of Bacillus licheniformis WX-02Δbcd with deletion of leucine dehydrogenase (bcd) gene:

[0025] 1. According to the bcd gene sequence in the Bacillus licheniformis WX-02 genomic DNA sequence, design the upstream homology arm primers (bcd-F1, bcd-R1) and downstream homology arm primers (bcd-F2, bcd-R2) of the bcd gene and using the genomic DNA of Bacillus licheniformis WX-02 as a template, carry out PCR amplification with the upstream homology arm primer and the downstream homology arm primer of the bcd gene respectively to obtain the upstream homology arm fragment of the bcd gene and the downstream homology arm fragment of the bcd gene Source arm fragment (the upstream homology arm fragment of bcd gene is 567bp; the downstream homology arm fragment of bcd gene is 591bp);

[0026] Wherein, the sequences of bcd-F1, bcd-R1, bcd-F2, bcd-R2 are:

[0027] bcd-F1:GATCTTTTCTACGAGCTCCACGTGCTGTCACATGTAGCA,

[0028] bcd-R1: TAGAGAATAGGGGTTATGATTTTACATTTTTTTATTCCTCCTCAT...

Embodiment 2

[0045] Construction of three foreign protein expression vectors:

[0046] Preparation of alkaline protease free expression plasmid pHY-AprE:

[0047] 1. With Bacillus licheniformis WX-02 genome DNA as template, design primer AprE-F / AprE-R to amplify the gene expression frame of alkaline protease gene aprE (shown in SEQ ID NO.2, comprise promoter, aprE gene and terminator) to obtain aprE gene sequence 1740bp;

[0048] 2. Using EcoRI and XbaI to digest the obtained aprE gene to obtain double-digested fragments;

[0049] 3. Using EcoRI and XbaI to perform double digestion on the Bacillus expression vector pHY300PLK to obtain the double digestion vector fragment;

[0050] 4. Ligate the double-digestion fragment and the double-digestion vector obtained in steps 2 and 3 with T4 DNA ligase to obtain the ligation product; transfer the ligation product into E. Under certain conditions, the medium containing tetracycline resistance was screened to obtain transformants, and the plasmi...

Embodiment 3

[0070] Construction and application of three kinds of genetically engineered bacteria expressing foreign proteins:

[0071] The alkaline protease free expression plasmid pHY-AprE, the keratinase free expression vector pHY-Ker, and the neutral protease free expression vector pHY-NprE were electrotransformed into Bacillus licheniformis WX-02Δbcd, using tetracycline resistance as a selection marker, and After colony PCR screening, using pHY-F and pHY-R as verification primers, PCR verification obtained positive transformants, and obtained the alkaline protease expression strain Bacillus licheniformis WX-02Δbcd / pHY-AprE, and the keratinase expression strain Bacillus licheniformis WX- 02Δbcd / pHY-Ker, neutral protease expression strain Bacillus licheniformis WX-02Δbcd / pHY-NprE;

[0072] In this example, the free expression plasmid pHY-AprE of alkaline protease, the free expression vector pHY-Ker of keratinase, and the free expression vector pHY-NprE of neutral protease were respecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention, which relates to the field of bacillus licheniformis gene engineering modification and protein efficient expression, discloses application of bacillus licheniformis without a bcd gene in protein production. According to the invention, the leucine dehydrogenase gene bcd in bacillus licheniformis WX-02 is knocked out through a genetic engineering method and thus the bacillus licheniformis WX-02 delta bcd lacking the gene bcd is successfully obtained; and alkaline protease AprE free expression plasmids pHY-AprE, a keratinase free expression vector pHY-Ker and a neutral protease free expression vector pHY-NprE are transferred. Compared with a control strain, the constructed engineering strain has a remarkable effect in the aspect of improving the enzyme activity of the protease,and the enzyme activity is improved by over 23%.

Description

technical field [0001] The present invention relates to the fields of genetic engineering and protein high-efficiency expression of Bacillus licheniformis, especially the application of Bacillus licheniformis lacking leucine dehydrogenase gene in the production of heterologous proteins, and the heterologous proteins include alkaline protease, Keratinase, neutral protease. Background technique [0002] Bacillus is a good host for high-efficiency expression of heterologous proteins, and Bacillus licheniformis is currently a common host strain for efficient industrial production of heterologous proteins, especially proteases. Protease is currently the most widely used enzyme product, widely used in food, medicine, chemical industry, waste treatment and other fields. Heterologous protein expression is an effective strategy to increase the expression level of the target protein. In recent years, more and more strategies have been developed to increase the synthesis level of tar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P21/00C12N15/53C12N1/21C12N15/03C12N9/50C12R1/10
CPCC12N9/0016C12Y104/01009C12N15/03C12N1/20C12N9/50
Inventor 陈守文蔡冬波莫非许勇占杨杨熊敏马昕吴晗嘉饶忆
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com