Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for identifying genetic genders of collichthys lucidus and application thereof

A technology of molecular markers and thorn plums, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems that have not been reported, and achieve a wide range of applicable materials and fish body damage. Small, wide-ranging effect on materials

Active Publication Date: 2020-01-10
JIMEI UNIV
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, there have been no reports of molecular markers that can identify and identify the genetic sex of spiny-headed plumfish at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for identifying genetic genders of collichthys lucidus and application thereof
  • Molecular marker for identifying genetic genders of collichthys lucidus and application thereof
  • Molecular marker for identifying genetic genders of collichthys lucidus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The applicant of the present invention took the spiny-headed plumfish caught in Sanduao, Ningde City, Fujian Province, China as a sample, constructed 12 groups of male and female spiny-headed plumfish genome resequencing data, and used the resequencing data to carry out genome-wide association analysis ( figure 1 ) results showed that the sex-significantly correlated regions were located on chromosomes 1, 2, 6, 7, 8, 11, 14, 17 and 22. Among them, chromosome 1 and chromosome 7 had the most significant correlation sites, concentrated in the near-end region of chromosome 7 and the front region of chromosome 1. Further in-depth comparative analysis of male and female genome resequencing data ( figure 2 ), and finally found a specific deletion of a sequence in the sex-significantly related region of chromosome 7 in the male spiny head scallion, and finally screened the specific deletion sequence in the male spiny head squid, which is shown in SEQID NO: 1 ( image 3 ).

...

Embodiment 2

[0043] The primer pairs of the present invention are used to carry out PCR amplification on the genomic DNA of the male and female spiny snails determined by anatomical examination, and the accuracy and specificity of the method of the present invention are verified by comparing the agarose gel electrophoresis patterns. The specific method steps are as follows:

[0044] Take 11 female and male adult fishes of spiny-headed plum for anatomical examination and identify 11 each, cut off part of the fin rays of spiny-headed plum, put them in the alcohol solution, and store them at -20°C for genome extraction; use phenol Genomic DNA was extracted by the chloroform method, and the obtained genomic DNA was uniformly diluted to 30ng / μL as a template for later use;

[0045] Primer F: 5'GGATCTTAAACTGTGTGCTCCATTC 3'; SEQ ID NO:2;

[0046] Primer R: 5'CAATACTGACCTGCTGATGTGTAAT 3'; SEQ ID NO:3.

[0047] Carry out PCR amplification reaction system with described primer: total reaction volu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker for identifying genetic genders of collichthys lucidus and application thereof. A nucleotide sequence of the molecular marker is as shown in SEQ ID NO:1; andan individual with the nucleotide sequence shown in missing SEQ ID NO:1 is genetic male collichthys lucidus. During detection, SEQ ID NO:2 and 3 are adopted as primers for PCR amplification, when amplified fragments are 460bp and 392bp, collichthys lucidus to be detected has genes of the nucleotide sequence shown in missing SEQ ID NO:1 and is the genetic male collichthys lucidus; and when the 460bp amplified fragment only exists, the collichthys lucidus to be detected does not have the genes of the nucleotide sequence shown in the missing SEQ ID NO:1 and is genetic female collichthys lucidus.The application of the molecular marker for identifying the genetic genders of the collichthys lucidus is suitable for before and after gonadal differentiation of the collichthys lucidus.

Description

technical field [0001] The invention relates to fish genetic sex identification and sex control technology in the technical field of aquatic organisms, in particular to a molecular marker for identifying the genetic sex of spiny-headed plum boy and its application. Background technique [0002] Sex determination mechanism is one of the hotspots in fish biology research. As a lower vertebrate, fish has rich and diverse sex determination modes, and it is an ideal model system for studying the evolution of sex determination in vertebrates. Understanding its sex-determining mechanisms could improve sex control and reproductive control techniques. In addition, the sex of fish is also closely related to its reproduction and many important economic traits, so sex control has received extensive attention in aquaculture. [0003] With the development of molecular biology techniques, various types of DNA molecular markers have been developed, including (1) restriction fragment lengt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6879C12N15/11
CPCC12Q1/6879
Inventor 蔡明夷肖俊竹邹禹陈俊男
Owner JIMEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com