SNP molecular marker related to shade of colors of green-eggshell egg shell of chicken and application of SNP molecular marker
A technology of molecular markers and eggshells, which is applied in the direction of recombinant DNA technology, measurement/testing of microorganisms, DNA/RNA fragments, etc., can solve the problems of slow genetic progress, high cost, long generation interval, etc., to improve genetic progress and reduce Feeding cost and the effect of improving production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Genome-wide association analysis
[0039] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD 260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / ul for genotyping.
[0040] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 1075 samples for subsequent analysis.
[0041] (3) Genome-wide association study (GWAS) method...
Embodiment 2
[0044] Example 2 Establishment of detection method for eggshell color alleles of green-shelled eggs
[0045] (1) Amplify a 237bp nucleotide fragment in the PIK3C2G gene of the target fragment primer of the SNP marker site significantly related to the eggshell color of green-egg eggs, and the upstream and downstream primers for sequence amplification are:
[0046] Upstream primer green-F: CTGATTTCTCTGGCTCCTGG (SEQ ID NO.1)
[0047] Downstream primer green-R: TGCTTCTGGAGATTGCTGTG (SEQ ID NO.2)
[0048] (2) PCR amplification:
[0049] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.
[0050] The genomic DNA of the L3 strain after three generations of selection and breeding of green-egg-producing individuals produced by crossing Dongxiang green-shell hens and Bai Laihang hens was used as a template, and PCR amplification was performed using primers green-F and green-R.
...
Embodiment 3
[0061] Example 3 Effect Analysis of Molecular Marker SNP rs312347405 C>G Mutation
[0062] A SNP molecular marker for improving the eggshell color of green-egg eggs provided by the present invention has an effect on the a value and b value of 32 weeks of age of 14.98% and 38.14% respectively, and the effect values on the eggshell color of other periods are also all within 5%. %above. Using the SNP markers to carry out molecular markers for assisted selection can significantly deepen the eggshell color of the green-egg eggs, and accelerate the eggshell color breeding process of the green-egg eggs.
[0063] Table 1 Analysis of the effect of SNP markers on the eggshell color of green-shelled eggs at different ages
[0064] %
[0065]
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com