Attenuated live vaccine for preventing toxoplasma gondii infection and application of attenuated live vaccine
A technology of live attenuated vaccine and Toxoplasma gondii, applied in anti-infective drugs, medical preparations containing active ingredients, invertebrate antigen components, etc., can solve problems such as unsatisfactory immune protection effect and inability to achieve complete protection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] A preparation method of a live attenuated vaccine for preventing Toxoplasma gondii infection according to the present invention, the implementation steps are as follows:
[0029] 1. Construction of knockout plasmid:
[0030] According to the GRA17 gene (TGME49_222170) in the Toxoplasma genome website TOXODB, the sgRNA was designed: GACTGTCCCTGAGGACCCAT and then the sgRNA in pSAG1::Cas9::U6sgUPRT was replaced by GRA17 using the Q5 site-directed mutagenesis kit to construct the plasmid pSAG1::Cas9::U6sgGRA17; DHFR-resistant fragments DHFR-F: AAGCTTTTACATCCGTTGC and DHFR-R: GAATTCCTGGCGAAATCAA were amplified from plasmid pUPRT-DHFR-D by primers;
[0031] NPT1 (TGME49_215490) gene design sgRNA: GATGAAGTGCAAGCTCCCG and then use Q5 site-directed mutagenesis kit to replace the sgRNA in pSAG1::Cas9::U6sgUPRT with NPT1 to construct plasmid pSAG1::Cas9::U6sgNPT1;
[0032] Ble-F: AAGCTTTTACATCCGTTGC and Ble-R: GAATTCCTGGCGAAATCAA were amplified from plasmid pSAG1-Ble by primers;
...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com