Application of a soybean nac transcription factor family gene glyma08g41995

A technology of transcription factor and family, which is applied in the application field of soybean NAC transcription factor family gene Glyma08g41995, can solve the problem that NAC transcription factors are not exactly the same, and can reduce the phenomenon of split pods, the number of branches and the height of plants. Effect

Active Publication Date: 2022-03-25
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are a large number of NAC transcription factors, different NAC transcription factors play different roles in biological functions. Therefore, the functions of new NAC transcription factor genes still need further experimental verification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a soybean nac transcription factor family gene glyma08g41995
  • Application of a soybean nac transcription factor family gene glyma08g41995
  • Application of a soybean nac transcription factor family gene glyma08g41995

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Cloning and identification of soybean Glyma08g41995 and its encoding gene

[0033] Primers were designed according to the sequence information of Glyma08g41995 predicted by the phytozome website, and the flower cDNA of Willmas82 in full bloom was used as a template for PCR amplification.

[0034] Upstream primer Gm08g41995-F: ggatcttccagagatCTTTGGCGTGGTTTGGA; (SEQ ID NO.3)

[0035] Downstream primer Gm08g41995-R: ctgccgttcgacgatCAATCAATGGAAAAGGGA. (SEQ ID NO. 4)

[0036]The Glyma08g41995 gene was amplified from the total RNA of soybean flower organs by RT-PCR. Take the soybean flower tissue, grind it with a mortar, add a 1.5mL EP tube containing the lysis solution, shake it sufficiently, and then transfer it into a glass homogenizer. After homogenization, it was transferred to a 1.5mL EP tube, and total RNA was extracted using a plant total RNA extraction kit (TIANGEN DP404). The total RNA quality was identified by formaldehyde denaturing gel electrophores...

Embodiment 2

[0037] Example 2 Expression characteristics of Glyma08g41995 in different organs of soybean

[0038] RNA was extracted from roots, stems, leaves, flowers, 7d pods, 15d pods, 25d pods, 45d pods and seeds of Willmas82, and reversed into cDNA for RT-PCR analysis.

[0039] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as the internal reference gene, and its amplification primer was the Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG (SEQ ID NO.5), and the Tubulin reverse primer sequence: CACTTACGCATCACATAGCA (SEQ ID NO.6). Real-time quantitative PCR analysis was performed using cDNA from different soybean tissues or organs as templates. The amplification primers for Glyma08g41995 were: qGm41995-F: TGGATTTAGATTCCATCCCACA (SEQ ID NO. 7), qGm41995-R: GCCTTTGCCAGCACTTCC (SEQ ID NO. 8). result ( figure 2 ) analysis showed that the expression of Glyma08g41995 was relatively high in flowers and pods, suggesti...

Embodiment 3

[0040] Example 3 Subcellular localization of Glyma08g41995

[0041] Subcellular localization adopts the method of tobacco transient expression, the vector used is pGFC5941, the primers are P2-Gm41995-F:acaaatctatctctctcgagATGAATGCTAAGGTACATAGCTCTG (SEQ ID NO.9), P2-Gm41995-R:gctcaccatggatccGAAAAGTAGGGTGGAATATATGTTCC (SEQ ID NO.10). PCR amplification, after the target band is correct, the gel is recovered by tapping, and the recovered product is connected to the vector by homologous recombination to construct the subcellular localization vector P2-Glyma08g41995 (the gene is at the N-terminus of GFP), and the infection solution is prepared and injected into the The backside of tobacco leaves grown for about 60 days was cultured in the dark for 48 hours after transient expression, and irradiated with Zeiss, LSM780 laser confocal microscope to observe the localization of the GFP reporter gene. The result is as image 3 As shown, the transfected plasmid was distributed in the whol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses the application of a soybean NAC transcription factor family gene Glyma08g41995. The constructed plant overexpression vector pMDC83‑Gm08g41995 was heterologously expressed in the wild type of Arabidopsis, and it was found that the transgenic plants were dwarfed, the number of branches and pods was significantly reduced, and the maturity period was delayed. It shows that the gene can be introduced into plants as the target gene, and the early bursting of pods of transgenic plants can be suppressed by overexpressing the Glyma08g41995 gene. It can be seen that the soybean Glyma08g41995 protein coding gene Glyma08g41995 of the present invention can suppress pod cracking and reduce pod cracking through genetic engineering, thereby reducing the loss of soybean yield caused by pod cracking, and has important application value.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and relates to the application of a soybean NAC transcription factor family gene Glyma08g41995. Background technique [0002] NAC (NAM, ATAF1 / 2, CUC2) protein is a widespread and huge family of specific transcription factors in plants, and it is also one of the largest transcription factor families in plants (Aida et al, 1997). The structure of the vast majority of NAC proteins is that there is a conserved DNA-binding domain of about 150 amino acids in length at the N-terminus, and the transcriptional domain is located at the C-terminus. They are involved in a variety of biological processes in plants and play extremely important functions in growth and development and stress response mechanisms. Therefore, the mining and functional research of NAC transcription factors has become a hot spot in the study of plant growth, development and stress response. Topics (Wang Fang et al, 2019). W...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/08A01H5/02A01H6/20
CPCC07K14/415C12N15/8261C12N15/827
Inventor 黄方王慧李亚丽阚贵珍程浩王娇喻德跃
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap