Application of a soybean E3 ubiquitin ligase family gene gmrnf1a
A technology of soybeans and coding genes, applied in the direction of ligase, application, genetic engineering, etc., can solve the problems of incomplete effects, etc., and achieve the effect of increasing thousand-grain weight, increasing yield, and reducing the phenomenon of plant pod cracking
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Cloning and identification of soybean GmRNF1a and its coding gene
[0030] Primers were designed according to the sequence information of GmRNF1a predicted by the phytozome website, and the flower cDNA of Willmas82 in full flowering stage was used as a template for PCR amplification.
[0031]Upstream primer GmRNF1a-F: ggatcttccagagatGCTTCTTCACTTCTTCCATTCTCC; (SEQ ID NO.3)
[0032] Downstream primer GmRNF1a-R: ctgccgttcgacgatCCTTATTGTAAACGTCGTTATCAGC. (SEQ ID NO.4)
[0033] The GmRNF1a gene was amplified from the total RNA of soybean floral organs by RT-PCR. Take the soybean flower tissue, grind it with a mortar, add it into a 1.5mL EP tube filled with lysate, shake it fully, and then transfer it into a glass homogenizer. After homogenization, transfer to 1.5mLEP tube, and use plant total RNA extraction kit (TIANGEN DP404) for total RNA extraction. The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA conte...
Embodiment 2
[0034] Example 2 Expression characteristics of GmRNF1a in different organs of soybean
[0035] Extract RNA from roots, stems, leaves, flowers, 7d pods, 15d pods, 25d pods, 35d pods, 45d pods and seeds of Willmas82, reverse to cDNA for RT-PCR analysis.
[0036] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as an internal reference gene, and the amplification primers were Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG (SEQ ID NO.5), and Tubulin reverse primer sequence: CACTTACGCATCACATAGCA (SEQ ID NO.6). Using cDNA from different soybean tissues or organs as templates, real-time fluorescent quantitative PCR analysis was carried out. The amplification primers of GmRNF1a are: GmRNF1a-qPCR-F: CCGTGGATAGAACTCAACTCG (SEQ ID NO.7), GmRNF1a-qPCR-R: GTCCTGAGCCCGTAGAAATC (SEQ ID NO.8). result( figure 2 ) analysis showed that the expression of GmRNF1a in flowers and pods was relatively high, especially in the...
Embodiment 3
[0037] Example 3 Subcellular localization of GmRNF1a
[0038] Subcellular localization adopts the method of transient expression of Arabidopsis protoplasts, the vector used is pAN580, and the primers are GmRNF1a-AN-F: aagtccggagctagctctagATGGCGGCGACGGCGACG (SEQ ID NO.9), GmRNF1a-AN-R: gcccttgctcaccatggatccGCAAGCCGAATCGCCGCCA (SEQ ID NO.10 ). PCR amplification, after the target band is correct, it is recovered by tapping the rubber, and the recovered product of the rubber is connected to the carrier by homologous recombination to construct the subcellular localization vector pAN580-GmRNF1a (the gene is at the N-terminal of GFP), and Arabidopsis protoplasts are transiently After expression, it was cultured in the dark for 16 hours, and after laser irradiation by a laser confocal microscope (Zeiss, LSM780), a green fluorescent signal could be generated, the protein was located, observed and photographed. The result is as image 3 As shown, the transformed empty plasmid is distr...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap