Application of soybean NAC transcription factor family gene Glyma08g41995

A technology of transcription factor and family, which is applied in the application field of soybean NAC transcription factor family gene Glyma08g41995, and can solve the problem that the functions of NAC transcription factors are not completely the same

Active Publication Date: 2019-10-01
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are a large number of NAC transcription factors, different NAC transcription factors play different roles in biological functions. Therefore, the functions of new NAC transcription factor genes still need further experimental verification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean NAC transcription factor family gene Glyma08g41995
  • Application of soybean NAC transcription factor family gene Glyma08g41995
  • Application of soybean NAC transcription factor family gene Glyma08g41995

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Cloning and identification of soybean Glyma08g41995 and its coding gene

[0033] Primers were designed according to the sequence information of Glyma08g41995 predicted on the phytozome website, and the flower cDNA of Willmas82 in full flowering stage was used as a template for PCR amplification.

[0034] Upstream primer Gm08g41995-F: ggatcttccagagatCTTTGGCGTGGTTTGGA; (SEQ ID NO.3)

[0035] Downstream primer Gm08g41995-R: ctgccgttcgacgatCAATCAATGGAAAAGGGA. (SEQ ID NO.4)

[0036]The RT-PCR method was used to amplify the Glyma08g41995 gene from the total RNA of soybean flower organs. Take the soybean flower tissue, grind it with a mortar, add it into a 1.5mL EP tube filled with lysate, shake it fully, and then transfer it into a glass homogenizer. After homogenization, transfer to 1.5mL EP tube, and use plant total RNA extraction kit (TIANGEN DP404) for total RNA extraction. The quality of total RNA was identified by formaldehyde denaturing gel electrophoresi...

Embodiment 2

[0037] Example 2 Expression characteristics of Glyma08g41995 in different organs of soybean

[0038] Extract RNA from roots, stems, leaves, flowers, 7d pods, 15d pods, 25d pods, 45d pods and seeds of Willmas82, reverse to cDNA for RT-PCR analysis.

[0039] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as an internal reference gene, and the amplification primers were Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG (SEQ ID NO.5), and Tubulin reverse primer sequence: CACTTACGCATCACATAGCA (SEQ ID NO.6). Using cDNA from different soybean tissues or organs as templates, real-time fluorescent quantitative PCR analysis was carried out. The amplification primers of Glyma08g41995 are: qGm41995-F: TGGATTTAGATTCCATCCCACA (SEQ ID NO.7), qGm41995-R: GCCTTTGCCAGCACTTCC (SEQ ID NO.8). result ( figure 2 ) analysis showed that the expression of Glyma08g41995 in flowers and pods was relatively high, indicating that G...

Embodiment 3

[0040] Subcellular Localization of Example 3 Glyma08g41995

[0041] For subcellular localization, the method of transient expression in tobacco was used, the vector used was pGFC5941, and the primers were P2-Gm41995-F: acaaatctatctctctcgagATGAATGCTAAGGTACATAGCTCTG (SEQ ID NO.9), P2-Gm41995-R: gctcaccatggatccGAAAAGTAGGGTGGAATATATGTTCC (SEQ ID NO.10). PCR amplification, after the target band was correct, the rubber was recovered by tapping, and the recovered product was connected to the carrier by homologous recombination to construct the subcellular localization vector P2-Glyma08g41995 (the gene is at the N-terminal of GFP), and the infection solution was prepared and injected into The back of tobacco leaves grown for about 60 days were cultured in the dark for 48 hours after transient expression, and laser irradiation was performed using a Zeiss, LSM780 laser confocal microscope to observe the localization of the GFP reporter gene. The result is as image 3 As shown, the tran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses the application of a soybean NAC transcription factor family gene Glyma08g41995. A constructed plant over-expression vector pMDC83-Gm08g41995 is heterologously expressed in wild type arabidopsis, and it is found that transgenic plants are dwarf, the branch number and the pod number are significantly reduced, and the maturity period is delayed. It shows that the gene can beintroduced into plants as a target gene, and through over-expression of the gene Glyma08g41995, pod cracking of the transgenic plants can be inhibited. It can be seen that the soybean Glyma08g41995 protein coding gene Glyma08g41995 can inhibit cracking of pods through genetic engineering, reduce cracked pods so as to reduce soybean yield loss caused by cracking of the pods, and the soybean NAC transcription factor family gene Glyma08g41995 has important application value.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and relates to the application of a soybean NAC transcription factor family gene Glyma08g41995. Background technique [0002] NAC (NAM, ATAF1 / 2, CUC2) protein is a large and widespread family of specific transcription factors in plants, and it is also one of the largest transcription factor families in plants (Aida et al, 1997). The structure of most NAC proteins is that there is a conserved DNA binding domain with a length of about 150 amino acids at the N-terminus, while the transcriptional domain is located at the C-terminus. They are involved in various biological processes in plants, and they play extremely important functions in growth and stress response mechanisms. Therefore, the mining and function research of NAC transcription factors has become a hot spot in the current study of plant growth and stress response. topic (Wang Fang et al., 2019). Genome-wide studies have shown th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/08A01H5/02A01H6/20
CPCC07K14/415C12N15/8261C12N15/827
Inventor 黄方王慧李亚丽阚贵珍程浩王娇喻德跃
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap