Application of soybean E3 ubiquitin ligase family gene GmRNF1a

A soybean, coding gene technology, applied in the direction of ligase, application, genetic engineering, etc., can solve problems such as different functions

Active Publication Date: 2018-11-23
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are a large number of E3 ubiquitin ligases, different E3 ubiquitin ligases play different biological functions. Therefore, the function of the new E3 ubiquitin ligase gene still needs further experimental verification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean E3 ubiquitin ligase family gene GmRNF1a
  • Application of soybean E3 ubiquitin ligase family gene GmRNF1a
  • Application of soybean E3 ubiquitin ligase family gene GmRNF1a

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Cloning and identification of soybean GmRNF1a and its coding gene

[0032]Primers were designed according to the sequence information of GmRNF1a predicted by the phytozome website, and the flower cDNA of Willmas82 in full flowering stage was used as a template for PCR amplification.

[0033] Upstream primer GmRNF1a-F: ggatcttccagagatGCTTCTTCACTTCTTCCATTCTCC; (SEQ ID NO.3)

[0034] Downstream primer GmRNF1a-R: ctgccgttcgacgatCCTTATTGTAAACGTCGTTATCAGC. (SEQ ID NO.4)

[0035] The GmRNF1a gene was amplified from the total RNA of soybean floral organs by RT-PCR. Take the soybean flower tissue, grind it with a mortar, add it into a 1.5mL EP tube filled with lysate, shake it fully, and then transfer it into a glass homogenizer. After homogenization, transfer to 1.5mLEP tube, and use plant total RNA extraction kit (TIANGEN DP404) for total RNA extraction. The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA conte...

Embodiment 2

[0036] Example 2 Expression characteristics of GmRNF1a in different organs of soybean

[0037] Extract RNA from roots, stems, leaves, flowers, 7d pods, 15d pods, 25d pods, 35d pods, 45d pods and seeds of Willmas82, reverse to cDNA for RT-PCR analysis.

[0038] The extraction of total RNA was the same as in Example 1. The soybean constitutively expressed gene Tubulin was used as an internal reference gene, and the amplification primers were Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG (SEQ ID NO.5), and Tubulin reverse primer sequence: CACTTACGCATCACATAGCA (SEQ ID NO.6). Using cDNA from different soybean tissues or organs as templates, real-time fluorescent quantitative PCR analysis was carried out. The amplification primers of GmRNF1a are: GmRNF1a-qPCR-F: CCGTGGATAGAACTCAACTCG (SEQ ID NO.7), GmRNF1a-qPCR-R: GTCCTGAGCCCGTAGAAATC (SEQ ID NO.8). result( figure 2 ) analysis showed that the expression of GmRNF1a in flowers and pods was relatively high, especially in the...

Embodiment 3

[0039] Example 3 Subcellular localization of GmRNF1a

[0040] Subcellular localization adopts the method of transient expression of Arabidopsis protoplasts, the vector used is pAN580, and the primers are GmRNF1a-AN-F: aagtccggagctagctctagATGGCGGCGACGGCGACG (SEQ ID NO.9), GmRNF1a-AN-R: gcccttgctcaccatggatccGCAAGCCGAATCGCCGCCA (SEQ ID NO.10 ). PCR amplification, after the target band is correct, it is recovered by tapping the rubber, and the recovered product of the rubber is connected to the carrier by homologous recombination to construct the subcellular localization vector pAN580-GmRNF1a (the gene is at the N-terminal of GFP), and Arabidopsis protoplasts are transiently After expression, it was cultured in the dark for 16 hours, and after laser irradiation by a laser confocal microscope (Zeiss, LSM780), a green fluorescent signal could be generated, the protein was located, observed and photographed. The result is as Figure 3-5 As shown, the transformed empty plasmid is di...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of a soybean E3 ubiquitin ligase family gene GmRNF1a. The nucleotide sequence of a soybean GmRNF1a protein encoding gene GmRNF1a is as follows: SEQ ID NO. 1. A constructed plant over-expression vector pMDC83-GmRNF1a is subjected to heterologous expression in a wild type of arabidopsis thaliana to find out that a transgenic plant ripening progress is obviously accelerated and fruit pods are opened in advance. The application shows that the gene can be used as a target gene and is imported into plants; the fruit pods of transgenic plants are inhibited from being opened in advance through inhibiting the expression of the GmRNF1a gene. Visibly, the soybean GmRNF1a protein encoding gene GmRNF1a provided by the invention can promote plants to become ripe in advance through genetic engineering, and application of the gene to the aspect of the opening time of the fruit pods of the plants is regulated and controlled.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and relates to the application of a soybean E3 ubiquitin ligase family gene GmRNF1a. Background technique [0002] Fruit development and maturity are important links in the growth and development of higher plants. They are closely related to crop yield and agricultural product quality, which in turn affects economic benefits. Timely pod cracking is conducive to seed collection, and premature cracking or non-cracking will affect the quality of agricultural products. reward. When soybeans are harvested, pod dehiscence is an important factor affecting soybean yield. Wang Tingting (2016) in our laboratory screened the soybean pod cDNA library through GmAGL1 and found some proteins that can interact with GmAGL1. One of the interacting proteins, Glyma15g42250.1 (gene number Glyma.15G268100.1 in V2.0 version), belongs to the E3 ubiquitin ligase family and contains a RING-finger domain, which ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/82A01H5/00A01H6/20
CPCC12N9/93C12N15/8266C12Y603/02019
Inventor 黄方王慧崔艳梅阚贵珍喻德跃
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap