Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Fluorescent quantitative test strip for porcine epidemic diarrhea virus, and preparation method and application thereof

A fluorescence quantitative detection, porcine epidemic diarrhea technology, applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of piglet death, economic losses in the pig industry, and high prices, to avoid subjectivity deviation, and to achieve good clinical application value. Effect

Active Publication Date: 2019-08-30
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI +2
View PDF13 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In October 2010, the mutation of PEDV triggered a large-scale outbreak of PED in my country, resulting in the death of a large number of piglets and causing huge economic losses to the pig industry in my country.
The colloidal gold test strips commonly used in the market to detect PEDV antigens are mainly from South Korea, and the price is relatively high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative test strip for porcine epidemic diarrhea virus, and preparation method and application thereof
  • Fluorescent quantitative test strip for porcine epidemic diarrhea virus, and preparation method and application thereof
  • Fluorescent quantitative test strip for porcine epidemic diarrhea virus, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1 Preparation of anti-PEDV N protein monoclonal antibody

[0043] 1 method

[0044] 1.1 Amplification of PEDV N gene and construction of recombinant plasmid

[0045] Viral RNA was extracted according to the instructions of the viral genome RNA extraction kit (RNeasy Mini Kit, QIAGEN). After the RNA was synthesized into cDNA by reverse transcription, specific primers (PEDV-N-F1 :CTG GGATCC ATGGCTTCTGTCAGTTTTTCAG; PEDV-N-R1326:CCG CTCGAG TTAATTTCCTGTGTCGAAG) amplifies the PEDV N gene. The PCR reaction conditions were pre-denaturation at 98°C for 30s, followed by 30 cycles of amplification at 98°C for 10s, 60°C for 30s, 68°C for 1min, and extension at 68°C for 7min. After the PCR product was identified by nucleic acid gel electrophoresis, the PCR product and pGEX-6p-1 empty vector were cut with BamH I and Xho I restriction endonucleases, and the target gene was obtained by gel recovery, and the obtained target gene was processed by T4DNA ligase (NEB ) con...

Embodiment 2

[0068] The assembly of embodiment 2 test strips and its application in detecting PEDV

[0069] 1 method

[0070] 1.1 Preparation of PEDV antibody fluorescent microsphere markers

[0071] Take 100 μL of Eu fluorescent microspheres with a solid content of 1% (Nanjing Weicei Biotechnology Co., Ltd.) and dilute it in 400 μL of 0.05 mol / L borate buffer solution with pH 8.0, and add 30 μL of 10 mg / mL carbodiimide (EDC) (purchased from Shanghai Crystal Pure Biochemical Technology Co., Ltd.) and 60 μL of 10 mg / mL N-hydroxysuccinimide (NHS) (purchased from Shanghai Crystal Pure Biochemical Technology Co., Ltd.), placed on a rotary shaker at room temperature at 50 rpm After activation for 15 minutes, centrifuge at 40,000g for 10 minutes, remove the supernatant solution, redissolve with 0.05mol / L borate buffer at pH 8.0, then ultrasonicate at 80W for 30s, and add 50 μg of PEDV monoclonal antibody 15B12 (preserved by CGMCC NO. 16299 hybridoma cells), placed on a rotary shaker at room te...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a fluorescent quantitative test strip for the porcine epidemic diarrhea virus (PEDV), and a preparation method and application thereof. The fluorescent quantitative test strip comprises a sample pad, a fluorescent label binding pad sprayed with a fluorescent label probe, a nitrocellulose membrane sprayed with a detection line T and a quality control line C, and a piece of absorbent paper that are arranged sequentially in the order of connection. The fluorescent quantitative test strip further comprises a plastic bottom liner arranged in the lower part. The plastic bottom liner is configured to provide an assembly platform; the fluorescent label binding pad is sprayed with a PEDV monoclonal antibody fluorescent microsphere label and a goat-anti-rabbit IgG fluorescent microsphere label; and the nitrocellulose membrane is sprayed with a detection line T formed by the PEDV monoclonal antibody and a quality control line C formed by the goat-anti-rabbit IgG polyclonal antibody. Experiments have proved that by using the test strip provided by the present invention, the sensibility is at least 10 times higher than that by using the existing RT-PCR and colloidal gold test strip detection method, the test sample is initially quantified, and the test result is digitized, so that the human subjective bias is avoided, and a technical means is provided for early diagnosis of the PEDV.

Description

technical field [0001] The invention relates to a fluorescent quantitative detection test strip and its preparation method and application, in particular to a fluorescent quantitative detection test strip for detecting porcine epidemic diarrhea virus and its preparation method and application. The invention belongs to the technical field of virus detection. Background technique [0002] Porcine epidemic diarrhea (Porcine epidemic diarrhea, PED) is an acute intestinal infectious disease caused by porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV), the main clinical features are diarrhea, vomiting and dehydration, its clinical symptoms, pathological changes It is very similar to porcine transmissible gastroenteritis virus (TGEV) and difficult to distinguish. PEDV infection can occur in pigs of different ages, among which piglets are the most seriously infected, and the morbidity and mortality often reach 100%. PEDV has been widely transmitted in pigs in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/533G01N33/569
CPCG01N33/533G01N33/56983
Inventor 冯力刘建波时洪艳肖理文
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com