Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of drugs that increase iron transport from the ventral hippocampus to the medial prefrontal cortex in the preparation of drugs for the treatment of neuropsychiatric diseases

A technology for neuropsychiatric diseases and ferroportin, which can be used in the field of medical biology to solve problems such as iron depletion

Active Publication Date: 2021-06-22
SOUTHERN MEDICAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Overexpression of FPN in tissue culture cells leads to intracellular iron depletion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of drugs that increase iron transport from the ventral hippocampus to the medial prefrontal cortex in the preparation of drugs for the treatment of neuropsychiatric diseases
  • Application of drugs that increase iron transport from the ventral hippocampus to the medial prefrontal cortex in the preparation of drugs for the treatment of neuropsychiatric diseases
  • Application of drugs that increase iron transport from the ventral hippocampus to the medial prefrontal cortex in the preparation of drugs for the treatment of neuropsychiatric diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Pharmacological / pharmacological experimental research on the brain iron transport pathway

[0041] 1. Iron chelation experiment in specific brain regions:

[0042] After anesthetized by intraperitoneal injection of 4% chloral hydrate, the mice were fixed on the mouse adapter of the stereotaxic instrument, and the eyes were kept moist with eye ointment. After cutting off the hair, disinfect the skin, cut the head skin along the midline, remove the surface connective tissue to expose the skull, adjust the position and direction of the anterior and posterior bregma, and locate according to the following coordinates.

[0043] Ventral hippocampus (AP: -3.28mm; ML: ±3.25mm; DV: -4.50mm)

[0044] Medial prefrontal cortex (AP:+1.78mm; ML:±0.3mm; DV:-2.75mm)

[0045] Substantia nigra (AP:-3.40mm; ML:±1.5mm; DV:-4.50mm)

[0046] Dorsal hippocampus (AP:-1.70mm; ML:±1.0mm; DV:-2.00mm)

[0047] Striatum (AP:+1.10mm; ML:±1.5mm; DV:-3.50mm)

[0048] Globus pallidum (AP...

Embodiment 2

[0064] Example 2: Anti-anxiety pharmacodynamic / pharmacological experimental research on enhancing iron transport from ventral hippocampus to medial prefrontal cortex

[0065] 1. Overexpression of iron transporter in the ventral hippocampus increases iron transport in the dorsal hippocampus → medial prefrontal cortex:

[0066] Firstly, retrovirus was injected in the medial prefrontal cortex to mark the neurons projecting to the upper level of the medial prefrontal cortex, and two weeks later, a virus overexpressing ferroportin was injected in the ventral hippocampus to make the neurons projecting to the medial prefrontal cortex Neurons in the ventral hippocampus overexpressed iron transporter, and iron concentrations in behavioral and brain regions were measured two weeks later.

[0067] Retrovirus: AAV2-RETRO-hSyn-cre

[0068] Titer: 2.28E+13v.g / ml

[0069] Production company: brainVTA, China

[0070] Item No.: PT-0136

[0071] Virus overexpressing ferroportin (human origi...

Embodiment 3

[0092] Example 3: Anxiolytic Pharmacological / Pharmacological Experimental Study on Reducing Iron Transport from Ventral Hippocampus → Medial Prefrontal Cortex

[0093] Similar to the method used in Example 2, the expression of ferroportin was disturbed in neurons in the ventral hippocampus projecting to the medial prefrontal cortex layer, and the overexpressed transferrin was detected by open field test, black and white box test, elevated test, etc. Behaviors such as exercise and anxiety in protein mice.

[0094] Retrovirus: AAV2-RETRO-hSyn-cre

[0095] Titer: 2.28E+13v.g / ml

[0096] Production company: brainVTA, China

[0097] Item No.: PT-0136

[0098] Interfering virus (mouse origin, interfering with the expression of ferroportin): AAV2 / 8-CMV-DIO-EGFP-FPN-shRNA

[0099] Titer: 2.15E+13v.g / ml

[0100] Production company: Obio Technology, China

[0101] Construct gene sequence: Gene ID: NM_016917.FPN shRNA: CAGACATGAATGCTACCATTA

[0102] Interference control virus: AAV...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of the medicine for increasing the iron transport from the ventral hippocampus to the medial prefrontal cortex layer in the preparation of the medicine for treating neuropsychiatric diseases. The inventors overexpressed human ferroportin in neurons in the ventral hippocampus projecting to the medial prefrontal cortex layer. It was found that after 14 days of overexpression virus expression, the iron concentration in the medial prefrontal cortex layer was significantly increased, demonstrating that this method can increase iron transport from the ventral hippocampus → medial prefrontal cortex layer. Compared with the control mice, the overexpression mice showed an increased total movement distance, an increased intermediate time in the open field, a decreased time in the black box, and an increased time in the elevated open arm, showing anxiolytic-like behavior. After successful modeling, compared with normal controls, mice with increased iron transport after injection of deferiprone increased the time of elevated open arms, increased the number of times of entering open arms, and exhibited anxiolytic-like behaviors. In summary, increasing iron transport from the ventral hippocampus to the medial prefrontal cortex has preventive and therapeutic effects on anxiety.

Description

Technical field: [0001] The invention belongs to the field of medical biology, and in particular relates to the application of changing intracerebral iron transport in the preparation of medicines for treating neuropsychiatric diseases. Background technique: [0002] Mental illnesses include: depression, anxiety, bipolar disorder, schizophrenia and other psychosis, dementia, intellectual disability and developmental disabilities including autism. The burden of mental disorders continues to increase in all countries of the world, with significant health impacts and significant social, human rights and economic consequences. [0003] Iron is an essential trace element for the human body and participates in many important metabolic processes in the body: the transportation of blood oxygen, the oxidation reaction in mitochondria, the synthesis of proteins, the composition of coenzymes in biochemical reactions, etc. Iron in the brain is taken up from the periphery and enters the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/00A61P25/00A61P25/22
CPCA61K45/00A61P25/00A61P25/22
Inventor 朱心红朱旻桢曾元宁王卓
Owner SOUTHERN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com