Cold-tolerant correlative coding gene of oryza rufipogon in bud stage, and applications thereof
An encoding gene and wild rice technology, which is applied to a cold tolerance-related encoding gene in the budding stage of common wild rice and its application field, can solve the problems of rice seed germination obstruction, seed death, growth point stop growing, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Construction of Overexpression Vector of Common Wild Oryza sativa Cold Tolerance Related Gene WRCT-1 Gene
[0061] 1. Acquisition of WRCT-1 gene
[0062] Using the DNA of common wild rice Y12-4 (Oryzarufipogon Griff.) as a template, use the following primers primer1 and primer2 to perform PCR amplification to obtain the target gene:
[0063] primer1: 5'CGGGGTACCATGACGACAAAAGACCTTT 3';
[0064] primer2: 5' CTTAATTAATCAGCTGCGAACTCCATT 3'. After recovering and purifying the PCR product, it was connected to Zero (purchased from Beijing Quanshijin Company) sequencing vector, transformed into DH5α competent cells, and the positive clones were selected for sequencing.
[0065] Sequencing results show that the amplified PCR product sequence is the nucleotide sequence shown in SEQ ID No.1, the length is 1419bp, named WRCT-1 gene, and the amino acid sequence of the protein encoded by the WRCT-1 gene is shown in SEQ ID No. .2 shown.
[0066] 2. Construction of an overexpressio...
Embodiment 2
[0071] Cultivation of overexpressed WRCT-1 transgenic plants and identification of transgenic plants with increased expression level of cold tolerance-related gene WRCT-1 gene in common wild rice
[0072] 1. Cultivation of overexpressed WRCT-1 transgenic plants with increased expression levels of the cold tolerance-related gene WRCT-1 gene in common wild rice The recombinant vector PMDC32-WRCT-1 was transformed into indica and japonica rice through Agrobacterium tumefaciens EHA105, specifically Methods as below:
[0073] 1. Import the recombinant vector PMDC32-WRCT-1 obtained in Example 1 into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector PMDC32-WRCT-1; The recombinant Agrobacterium tumefaciens EHA105 of 1 was cultured at 28°C for 16 hours, and the bacterial cells were collected; the bacterial cells were diluted with N6 liquid medium (Sigma, catalog number C1416) containing 100 μM ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap