Use of Corilagin in the preparation of anti-myocardial fibrosis drugs
A technology for myocardial fibrosis and application, which is applied in the application field of corilagin in the preparation of anti-myocardial fibrosis drugs, can solve the problem of ineffective myocardial fibroblast proliferation, differentiation and abnormal activation, and no anti-myocardial remodeling Or anti-fibrosis drugs and other problems, to achieve the effect of alleviating the deterioration of heart function, reducing the deterioration of heart function, and less side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] [Example 1] Detection of Corilagin's Effects on Mouse Heart Function and Myocardial Fibrosis
[0040] (1) Mouse heart function test
[0041] Before sampling, the mouse heart was subjected to ultrasonic testing (ultrasonic testing instrument parameters: center frequency 10 MHz, burst frequency 50 Hz, window 75%, depth 4 cm) and hemodynamic testing. The result is as figure 1 As shown in A-D, the cardiac function of the mice in the operation group without drugs deteriorated, the left ventricular wall thickened, the ejection fraction decreased, and the intraventricular pressure decreased, while the wall thickness, ejection fraction and intraventricular pressure of the mice in the corilagin-administered group The blood pressure was improved (*p<0.05vs.Veh group, #p<0.05vs.AB group).
[0042] (2) Detection of myocardial fibrosis in mice
[0043] Real-time quantitative PCR was used to evaluate the transcription of fibrosis-related genes, and picric acid-sirius scarlet (PSR)...
Embodiment 2
[0061] [Example 2] Detection of the effect of corilagin on oxidative stress in mouse myocardial tissue
[0062] Real-time quantitative PCR was used to evaluate the transcription of antioxidant genes, Western blot was used to evaluate the expression level of antioxidant proteins, and 4-HNE immunohistochemical staining was used to evaluate oxidative stress. The result is as figure 2 As shown, the transcription of anti-oxidant genes such as SOD1, SOD2, GPx and CAT in the myocardium decreased, the expression of SOD1, SOD2 and HO-1 decreased, and the content of 4-HNE also decreased in the no-drug operation group; while in the corilagin administration group, The above-mentioned indexes of myocardial tissue all showed obvious recovery (*p<0.05vs.Veh group, #p<0.05vs.AB group).
[0063] The primer sequences for amplifying antioxidant genes are as follows:
[0064] SOD1:
[0065] F: TGTGCGTGCTGAAGGG
[0066] R: CATACTGATGGACGTGGAAC
[0067] SOD2:
[0068] F: CCGTCCGTGTCGCCGTCCTC...
Embodiment 3
[0077] [Example 3] Detection of Corilagin's Effect on Myocardial Tissue Inflammation in Mice
[0078] Real-time quantitative PCR was used to evaluate the transcription of pro-inflammatory and anti-inflammatory genes, and CD68 immunohistochemical staining was used to evaluate the degree of macrophage infiltration. The result is as image 3 As shown, the transcription levels of pro-inflammatory factors IL-6, IL-12, IL-1β, MCP-1 and TNF-α were increased, and the transcription levels of anti-inflammatory factors IL-1Rα and IL-10 were decreased in the no-drug operation group. The infiltration of phagocytic cells increased; the transcription levels of pro-inflammatory factors and the transcription of anti-inflammatory factors increased in myocardial tissue of Corilagin administration group, and the infiltration of macrophages decreased (*p<0.05vs.Veh group, #p<0.05vs.AB Group).
[0079] The primer sequences for amplifying pro-inflammatory factors or anti-inflammatory factors are a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap