Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method and detection kit for oligonucleotides of leukemia MEF2D-BCL9 fusion gene at different sites

A technology that combines genes and kits, applied in the fields of life sciences and biology, can solve the problems of high cost and low specificity, and achieve high accuracy, reduce false negatives and false positives, and low false positives

Pending Publication Date: 2019-04-09
ZHUJIANG HOSPITAL SOUTHERN MEDICAL UNIV +1
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, because SYBR GreenI is an unsaturated dye, its specificity is not as good as that of the double-probe hybridization method and the Taqman method, and its specificity must be judged by observing the melting curve, while the cost of the double-probe hybridization method is relatively expensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and detection kit for oligonucleotides of leukemia MEF2D-BCL9 fusion gene at different sites
  • Detection method and detection kit for oligonucleotides of leukemia MEF2D-BCL9 fusion gene at different sites
  • Detection method and detection kit for oligonucleotides of leukemia MEF2D-BCL9 fusion gene at different sites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] The preparation of embodiment 1 kit

[0069] 1. Design of Specific Primers and Probes

[0070] Specific probes and primers were designed according to gene sequences (ABL1 gene sequence, MEF2D-BCL9 gene sequence and their partner gene sequences were all from the National Center for Biotechnology Information Nucleic Acid Database).

[0071] ABL1 gene ID: 25, gene reference sequence NM_005157.6;

[0072] MEF2D gene ID: 4209, gene reference sequence: NM_001271629.1;

[0073] BCL9 gene ID: 607, gene reference sequence: NM_004326.4.

[0074] 2. Preparation of kit components

[0075] Primers and probes: including detection of MEF2D-BCL9 fusion genes at different sites and internal reference ABL1 primers and probes corresponding to the primers, as follows:

[0076] 202-968-F: GCAGCCAGCACTACAGAGGA SEQ ID No. 1

[0077] 202-968-R: CTCTGGAGGCATGGTATAAGGTGT SEQ ID No. 2

[0078] 202-968-Probe: FAM-CCCCACCTCCTACAGCCAGCC-BHQ1SEQ ID No.3

[0079] 221-968-F: GTGACCTGAACAGTGCTAAC...

Embodiment 2

[0092] Embodiment 2 The operation process of this test kit

[0093]1. Extraction of total RNA in bone marrow: Add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of bone marrow and mix well. Let stand at room temperature in the dark for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until The precipitate was completely dissolved, and stood on ice for 15 minutes; added 0.2ml of chloroform, oscillated evenly, and after standing on ice for 10 minutes, centrifuged at 12000rpm for 15 minutes; absorbed the supernatant and transferred it to another new centrifuge tube; added an equal volume of isopropanol, Mix well up and down, let stand on ice for 10 minutes, then centrifuge at 12000rpm at 4°C for 15min, discard the supe...

Embodiment 3

[0100] Example 3 Detection of leukemia specimens and clinical examination specimens

[0101] 1. A total of 14 bone marrow samples from B-ALL leukemia patients submitted for inspection were taken, and genomic RNA was extracted, reagents were prepared and tested according to the method described in Example 2. Add 2 μl of each sample to the detection system PCR reaction solution. Make positive, negative, and blank controls at the same time. Each sample is repeated twice, one positive control, one negative control, and one blank control. The detection time is only 98 minutes. When the internal reference, positive control, negative control, and blank control were all normal, because the MEF2D-BCL9 fusion gene is relatively rare in leukemia patients, all 14 leukemia samples were negative, that is, none of these 14 patients had MEF2D -Type of BCL9 fusion gene, the results are as follows:

[0102]

[0103] The above results show that the kit can detect samples with high throughp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method and kit for oligonucleotides of a leukemia MEF2D-BCL9 fusion gene at different sites. The kit comprises a detection system PRC reaction solution, a primer pair, probes, a positive control and a negative control. A Taqman probe technology in real-time fluorescence PCR is used for detecting the expression condition of the MEF2D-BCL9 fusion gene in a patient and performing more accurate screening and identification on high risk groups, the kit has good specificity and high sensitivity, and the method has the characteristics of convenience and high efficiency.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and in particular relates to a detection kit for detecting the MEF2D-BCL9 fusion gene of different sites of leukemia. Background technique [0002] The detection of fusion genes is of great significance for the treatment of leukemia. Through the detection of fusion genes, the prognosis and recurrence of leukemia can be judged more accurately. With the gradual advent of targeted drugs, the detection of fusion genes can help patients Implement more precise and individualized treatment. However, up to 30% of fusion genes are still unknown. [0003] MEF2D-BCL9 fusion gene is produced by the translocation of myocyte enhancer factor 2D (myocyteenhancer factor 2D, MEF2D) and B-cell lymphoma-9 gene (B-cell lymphoma-9, BCL9) both located at 1q21-22. In-frame fusions involving exon 5 or 6 of MEF2D to exon 9 or 10 of BCL9. MEF2D encodes a ubiquitously expressed transcription factor that play...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/166C12Q2600/118
Inventor 李玉华胡宇行常宁贺艳杰
Owner ZHUJIANG HOSPITAL SOUTHERN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com