Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing alpha-ketoisovaleric acid with high yield

A ketoisovaleric acid and amino acid technology, applied in the field of bioengineering, can solve the problems such as no application report of L-amino acid oxidase, complicated separation and purification, residual intermediate products, etc., and is conducive to large-scale industrial production and product purity. High, mild conditions

Pending Publication Date: 2019-02-22
JIANGNAN UNIV +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The production method of α-ketoisovaleric acid (α-KIV) includes chemical synthesis method and microbial method. The chemical synthesis method involves a series of chemical reaction processes with many and complicated steps, which is easy to cause environmental pollution, residual intermediate products, and later separation and purification complex
But there is no application report of L-amino acid oxidase in the catalytic reaction containing L-valine in the substrate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing alpha-ketoisovaleric acid with high yield
  • Method for producing alpha-ketoisovaleric acid with high yield
  • Method for producing alpha-ketoisovaleric acid with high yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1: Induced expression of recombinant genetically engineered bacteria

[0037] Construction process of recombinant bacteria:

[0038] (1) Using the genome of Corynebacterium glutamicum as a template, design primers for PCR to clone the gene encoding L-amino acid oxidase derived from Corynebacterium glutamicum. The primers used are: 5' ccgctcgagcggatgaaaattg cggtaatcgg 3' as forward primer , using 5'caagcttggataatgcacgtggcggagaaactaaccaagtac 3' as a reverse primer to amplify the target gene, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0039] (2) Digest the target gene and the expression vector pET-28a with restriction endonucleases XhoI and hindIII at 37°C for 2h;

[0040] (3) Ligate the target gene and plasmid pET-28a after digestion and gel recovery with T4 ligase at 16°C for 10 h;

[0041] (4) Introduce the constructed expression plasmid into E.coli BL21(DE3), and culture it on the LB plate containing kanamycin for 12h;

[0042] (5) Perfor...

Embodiment 2

[0044] Example 2: Effect of conversion temperature on the production of α-ketoisovaleric acid

[0045] The wet thallus obtained in Example 1 was used as a catalyst for whole cell transformation. The specific transformation reaction conditions are: pH = 8.0, transformation temperature is 20°C, 25°C, 30°C, 37°C, substrate concentration is 65g / L, bacterial mass is 30g / L, transformation system is 20mL, transform at different temperatures After 24h, utilize HPLC to analyze the conversion product and the α-ketoisovalerate sodium standard substance that buys, as figure 1 As shown, it was proved that the conversion product was sodium α-ketoisovalerate. Adopt high performance liquid chromatography to measure the concentration situation of α-ketoisovaleric acid in the supernatant after the reaction (as figure 2 Shown), the result shows: when temperature is 20 ℃, ketovaline concentration is 46g / L. When the temperature is 25°C, the concentration of ketovaline is 51g / L. When the tempera...

Embodiment 3

[0046] Example 3: Effect of inversion pH on the production of α-ketoisovaleric acid

[0047] The wet thallus obtained in Example 1 was used as a catalyst for whole cell transformation. The specific transformation reaction conditions are: pH=7-9.5, transformation temperature is 25°C, substrate concentration is 65g / L, bacterial mass is 30g / L, transformation system is 20mL, after transformation for 24 hours, use high performance liquid chromatography to determine The concentration of α-ketoisovaleric acid in the supernatant after the reaction (as image 3 shown), the results showed that when the pH was 7.0, the concentration of α-ketoisovalerate was 45.3g / L; when the pH was 7.5, the concentration of α-ketoisovalerate was 47.6g / L; when the pH was At 8.0, the concentration of α-ketoisovalerate is 51g / L; when the pH is 8.5, the concentration of α-ketoisovalerate is 49.4g / L; when the pH is 9.0, the concentration of α-ketoisovalerate It is 46.1g / L. When the pH is 9.5, the concentra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing alpha-ketoisovaleric acid with high yield, and belongs to the technical field of bioengineering. The method includes connecting a gene derived from Corynebacterium glutamicum encoded L-amino acid oxidase to an expression vector by a molecular biological means; introducing constructed expression plasmids into E. coli BL21 (DE3) and screening with a kanamycin-resistant plate to obtain a recombinant L-amino acid oxidase-containing engineered bacterium which is used for conversion of L-valine to produce alpha- ketoisovaleric acid. High-efficiency production of the alpha-ketoisovaleric acid is achieved by controlling temperature and pH and metal ions. The yield of the alpha-ketoisovaleric acid is up to 51 g / L with the conversion rate of 79.1% underthe condition that the temperature is 25 DEG C, pH=8.0, the biomass is 30 g / L, and the substrate concentration is 65 g / L.

Description

technical field [0001] The invention relates to a method for high-yielding α-ketoisovaleric acid, which belongs to the technical field of bioengineering. Background technique [0002] α-Ketoisovaleric acid (α-KIV), also known as ketovaline, is a branched chain keto acid with the molecular formula C 5 h 8 o 3 , the relative molecular mass is 116.12. α-Ketoisovaleric acid is an important intermediate, which is mainly used in food, medicine, cosmetics and other fields. Adding ketovaline to feed can promote muscle growth in livestock. α-keto acid has the effect of reducing renal filtration pressure and can be used to treat chronic uremia and nitrogen metabolism-related diseases. It is also an important raw material for vitamin B5. [0003] The production method of α-ketoisovaleric acid (α-KIV) includes chemical synthesis method and microbial method. The chemical synthesis method involves a series of chemical reaction processes with many and complicated steps, which is easy ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/40C12N1/21C12R1/19
CPCC12N9/0022C12P7/40C12Y104/03002
Inventor 吴静裴杉杉刘佳陈修来罗秋玲张权
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com