Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing PD1 humanized BALB/c mouse model and application thereof

A humanized and mouse technology, which is applied in the field of animal genetic engineering and genetic modification, can solve the problems of being easily suppressed, low PD1 response, and inhomogeneity, so as to enhance accuracy, ensure success rate, and expand extensiveness Effect

Active Publication Date: 2019-01-25
GEMPHARMATECH CO LTD
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Comparing the sensitivity of previous PD1 inhibitors on various mouse tumors, C57BL / 6 commonly used tumor-bearing MC38 is more sensitive to PD1 inhibitors and is easily suppressed
However, BALB / c commonly used tumor-bearing CT26 has a low and uneven response to PD1, which can better reflect the real situation of existing drugs in different human bodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing PD1 humanized BALB/c mouse model and application thereof
  • Method for constructing PD1 humanized BALB/c mouse model and application thereof
  • Method for constructing PD1 humanized BALB/c mouse model and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Establishment of BALB / c-PD1 humanized mouse model

[0051] 1. Determine the replacement region of the human fragment and the inserted human sequence

[0052] According to the binding domain of human PD1 and PDL1 protein, we selected Exon2 and 3 of human PD1 sequence to replace Exon2 and 3 of mouse PD1 (No. 11633 to 123333 of PD1 gene), and retained the transmembrane region and intracellular region of mouse PD1 , the selected human PD1 gene sequence is shown in SEQ No.1.

[0053] PD1人源化序列tccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgacaggtgcggcctcggaggccccggggcaggggtgagctgagccggtcctggggtgggtgtcccctcctgcacaggatcaggagctccagggtcgtagggcagggaccccccagctccagtccaggg...

Embodiment 2

[0109] Example 2 PD1 expression and functional verification of PD1 humanized mice

[0110] In this example, the transcription of human PD1 in heterozygotes is detected by mRNA, and then the expression of humanized genes in heterozygotes and homozygotes is analyzed by flow cytometry, and the immune cell populations are checked. After analysis, the humanized gene can be successfully expressed Genes, and mice that do not cause obvious abnormalities in the immune system can be used for tumor drug efficacy experiments.

[0111] 1. mRNA determination

[0112] The samples used in the experiment were humanized Pdcd153#♂(KI / wt) and BALB / c wild-type 54#♂(wt / wt). Extract 53#, 54# mouse spleen and thymus RNA for RT-PCR, and sequence the PCR products to verify whether the splicing of Pdcd1mRNA is correct. The sequencing results showed that the correct humanized mRNA was detected in the PCR product of 53#. The above results indicated that the chimeric mRNA splicing in humanized Pdcd1 mic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Average volumeaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for preparing a PD1 humanized BALB / c mouse model, this method utilizes CRIPSR / Cas9 technology, most extracellular domains of mouse PD1 were humanized by homologous recombination through constructing a targeting carrier, and the intracellular domains were still mouse sequences, and the intracellular signal transduction ability was preserved. The humanization model constructed by this method maximized the human domain (antibody binding domain) and avoided missing the effective antibody. At the same time, PD1 humanized model based on BALB / c can be inoculated with colorectal cancer, liver cancer, melanoma, breast cancer, kidney cancer and lymphoma to satisfy various solid tumor cell line types, and expand the application of the widespread.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering and genetic modification, and in particular relates to a method for constructing a humanized animal model of PD1 gene modification based on CRISPR / Cas9 technology and its application in biomedicine. Background technique [0002] As early as 2013, Science magazine rated tumor immunotherapy as the first of the top 10 scientific breakthroughs, among which the immune checkpoint therapy (Immuno-checkpoint therapy) headed by PD1 / PDL1 has shown significant effects in the clinical treatment of various cancers. Antitumor efficacy. At present, there are successful drugs on the market and used in clinical practice. Merck’s PD-1 humanized antibody Keytruda (Pembrolizumab, MK-3475) and Bristol-Myers Squibb’s PD-1 antibody Opdivo (Nivolumab) were approved by the FDA in 2014 The marketed first-line tumor treatment drug has a robust anti-tumor effect. At the same time, 15 PD-1 / PD-L1 drugs (domestic) ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/85C12N15/113A01K67/027
CPCA01K67/0275A01K2267/03C07K14/70521C12N15/113C12N15/85C12N2310/10
Inventor 琚存祥赵静李松杨笑柳张明坤侯欢欢高翔
Owner GEMPHARMATECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com