Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving cotton characters

A technology of cotton and traits, applied in the field of cultivating purple, anti-aging cotton, and cold resistance, can solve the problems of resource loss of spontaneous mutant library, complexity of cotton genetic background, etc.

Active Publication Date: 2019-01-18
ZHEJIANG SCI-TECH UNIV
View PDF14 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the low probability of spontaneous mutations and the complexity of the genetic background of cotton, even if some phenotypic variations are found, it is difficult to verify with molecular mechanisms, which eventually leads to the loss of resources in the spontaneous mutant library.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving cotton characters
  • Method for improving cotton characters
  • Method for improving cotton characters

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Acquisition and Gene Cloning of Cotton Violet Senescence-Resistant Mutants

[0048] 1. Acquisition of purple senescence-resistant mutants in cotton

[0049] The constructed T-DNA expression vector (pBI121) was transferred to Agrobacterium LB4404 for expanded culture, and the hypocotyls of cotton C312 seedlings were mixed with Agrobacterium LB4404 loaded with T-DNA vector in induction medium (MSB5 medium + 2,4- D (2,4-dichlorophenoxyacetic acid) 0.1 mg / L + KT (cytokinin) 0.1 mg / L) at 23°C for 36-48 hours. The embryogenic callus was washed with sterile water containing cephalosporin (500 mg / L). The embryogenic callus after cleaning is transferred to the resistance selection medium (MSB5 medium+IBA (indole acetic acid) 0.5mg / L+KT0.15mg / L+kanamycin 50mg / L) to screen for successful transformation Embryogenic callus. Inoculate the different callus pieces that differentiated and grown on the subculture medium (MSB5 medium+IBA0.5mg / L+KT0.2mg / L) respectively, pick o...

Embodiment 2

[0088] Example 2 Using RNAi to interfere with the GhOMT1 gene to cultivate purple senescence-resistant transgenic cotton

[0089] (1) Cloning the full-length GhOMT1 gene (shown in SEQ ID NO.1) according to Example 1, inserting the GhOMT1 gene forward into the plant expression vector pBI121-35S-NOS, using the CaMV35S promoter to promote expression, and constructing a GhOMT1 gene containing Gene plant expression vector pBI21-35S-GhOMT1-NOS, such as Figure 4 .

[0090] Insert the GhOMT1 gene fragment (shown in SEQ ID NO.1) into the plant interference expression vector pB7GWIWG2(II), use the CaMV35S promoter to promote expression, and construct the plant interference expression vector pB7GWIWG2(II)-GhOMT1-F- containing the GhOMT1 gene T35S, such as Figure 5 .

[0091] The constructed vector was heat-shocked to transform DH-5α Escherichia coli competent, and during this process, kanamycin LB medium was used to cultivate the recombinant. The plasmid pB7GWIWG2(II)-GhOMT1 extract...

Embodiment 3

[0094] Example 3 Using CRISPR-Cas9 Technology to Knockout the GhOMT1 Gene to Cultivate Violet Senescence-resistant Transgenic Cotton

[0095] 1. CRISPR / Cas9 system gene knockout vector of cotton GhOMT1 gene

[0096] 1) In order to obtain the 18-23bp guideRNA of the target gene GhOMT1 sequence, the only restrictive conditions for determining the target site according to the CRISPR / Cas9 system are the PAM site at the 3' end and the 18-22bp gRNA sequence at the front of the PAM. Look for the 23bp site, the standard recognition site form is GN19NGG, where NGG is the PAM sequence required for protein binding to the genome, and does not need to appear on the constructed vector, only the 20bp of GN19 in front of NGG needs to be placed in the vector. The first G in GN19 is the initiation signal required for small RNA transcription.

[0097] The guideRNA (gttccttttagtaaggcata) of the target gene GhOMT1 sequence was used to synthesize upstream and downstream primers (5'-GATTGN19-3', 3'...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for improving cotton characters, which inhibits or knocks out cotton anthocyanin methylation modifying gene GhOMT1. A change in cotton properties according to the present invention, By regulating the expression of anthocyanin modifying genes in the anthocyanin metabolic pathway, cells can not synthesize anthocyanin or anthocyanin, change the composition and contentof anthocyanin monomer, feedback activate anthocyanin biosynthesis, cause a large amount of anthocyanin or intermediate product accumulation, make plants appear purple, and anti-senescence, anti-freeze traits.

Description

(1) Technical field [0001] The invention relates to a method for cultivating purple, cold-resistant and anti-aging cotton by using the cotton anthocyanin methylation modification gene. (2) Background technology [0002] Cotton is one of the world's major fiber crops. Spontaneous plant mutations usually occur under natural conditions without the intervention of human factors. Wang Xuede reported the discovery of a fiberless cotton mutant in 2002, which provided materials for the study of cotton fiber generation mechanism and the cloning of cotton fiber-related genes (Jiang Shuli, Wang Xuede, Induction of ovules and fibers of 5 cotton fiber mutants in vitro, Cotton Journal, 2002, 14(2):71-75, 2002). Chen Xusheng et al. isolated naturally mutated subred mutants with high photosynthetic efficiency from upland cotton, and then found spontaneously mutated dwarfed strains (Chen Xusheng, cotton dwarf mutants, Cotton China, 2004, 31 (1): 26-26; Chen Xusheng, New Mutant of Upland C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/60
CPCC12N15/8213C12N15/825C12N15/8273
Inventor 柯丽萍孙玉强
Owner ZHEJIANG SCI-TECH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com