Application of P2X7 receptor in diagnosis and treatment of rheumatoid arthritis
A 1. P2X7, rheumatoid technology, applied in the field of biomedicine, can solve the problems of poor specificity and low sensitivity, and achieve the effect of overcoming low specificity, high sensitivity and accurate diagnosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041]Example 1 RT-PCR detection of P2X7 receptor levels in patients with rheumatoid arthritis
[0042] 1. Experimental method
[0043] (1) Preparation of cDNA
[0044] The synovial tissues of patients with rheumatoid arthritis and bone and joint replacement were obtained from the Third Affiliated Hospital of Guangzhou Medical University and Xintang Hospital, Zengcheng District, Guangzhou. The joint synovial tissue was collected aseptically. After the operation, the joint synovial tissue was taken in a clean and sterile 50mL centrifuge tube, placed on ice, and the fat tissue, bones, blood vessels, etc. were removed on the aseptic operating table, and then washed with PBS. 3 times; RNA was extracted and cDNA was prepared by reverse transcription.
[0045] (2)PCR primers
[0046] P2X7-F (SEQ ID NO: 1): ACGTTTGCTTTGCTCTGGTG;
[0047] P2X7-R (SEQ ID NO:2): ACCTTGGTGTGCACAGAACT.
[0048] Using the prepared cDNA as a template, a real-time fluorescent PCR experiment was carried ...
Embodiment 2
[0055] Example 2 ROC curve analysis of the diagnostic value of P2X7 receptors in patients with rheumatoid arthritis
[0056] 1. Experimental method
[0057] SPSS17.0 software was used to analyze the diagnostic value of P2X7 receptor in patients with rheumatoid arthritis.
[0058] 2. Experimental results
[0059] Experimental results such as figure 2 As shown, the ROC curve analysis results show that the AUC area is 0.884, indicating that the P2X7 receptor has a good value in the diagnosis of RA; at the same time, the ROC curve analysis shows that the sensitivity and specificity of the P2X7 receptor for the diagnosis of RA are 80% and 92%, respectively. The 95% confidence interval is 0.780-0.998.
Embodiment 3
[0060] Example 3 Correlation analysis between P2X7 receptor level and serum inflammatory cytokines IL-1β, IL-6 and IL-8 in patients with rheumatoid arthritis
[0061] 1. Experimental method
[0062] The levels of inflammatory cytokines L-1β, IL-6 and IL-8 in the serum of patients with rheumatoid arthritis were detected by enzyme-linked immunosorbent assay. Fresh sera from patients with rheumatoid arthritis were collected and detected by enzyme-linked immunosorbent assay. The kit uses the product of GeneStar Company. Specific steps: prepare the standard product dilution, collect the serum of patients with rheumatoid arthritis, operate according to the instructions of the enzyme-linked immunosorbent assay kit, and finally detect the optical density (ie, OD value) with a microplate reader. According to the standard absorbance value and the corresponding concentration technical standard curve, the levels of cytokines L-1β, IL-6 and IL-8 in the serum of patients with rheumatoid a...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com