Application of PBLD gene in preparation of medicine for diagnosing renal clear cell carcinoma and predicting prognosis of same
A renal clear cell carcinoma and gene technology, applied in the field of tumor molecular biology, can solve the problems of unreported significance, less than 10% productivity, and no obvious early symptoms of renal cancer. The method is simple and effective, the result is reliable, and the improvement The effect of detection performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] 1. qRT-PCR detection of PBLD mRNA expression levels in 50 pairs of ccRCC and corresponding paracancerous kidney tissue samples
[0019] 1.1 Primer design and synthesis
[0020] Design PBLD-specific primers with the following sequences: Forward: 5'- TCGTCTGGCCCTTAGTTCTC -3' Reverse: 5'-TGGTTTACACCAGCGAGTGA -3'.
[0021] Extraction of RNA from tissues
[0022] 1) Label the EP tubes, take out the tissues from the -80°C refrigerator, and add them in sequence, corresponding to the paracancerous tissue and the number, mash the cancerous tissue and the corresponding paracancerous tissue of each specimen separately, add 300 μl Trizo lysate to fully lyse the tissue, and then Add 700μl Trizo lysate and incubate at room temperature for 5min.
[0023] 2) Add 200 ul of chloroform (trichloromethane) to each EP tube, cover the EP tube, shake vigorously by hand for half a minute, incubate on ice for 10 min, and centrifuge at 1200 rpm for 15 min at 4°C.
[0024] 3) At this time, the ...
PUM
Property | Measurement | Unit |
---|---|---|
Thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com