Multi-component group B meningococcus vaccine and preparation method thereof
A meningococcal and multi-component technology is applied in the field of multi-component B meningococcal vaccine and its preparation, and can solve the problems of lack of bactericidal power and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Embodiment 1: Construction of group B meningococcal low endotoxin mutant strain:
[0082] In this embodiment, the ST4821 clone group 341215 strain of meningococcus B epidemic strain is taken as an example.
[0083] 1.1 According to the lpxA gene sequence of group B meningococcus, design and synthesize primers as follows:
[0084] 5' TGATTACGCCAAGCTTCAAAAACTCATCCCCCCA 3'
[0085] 5'TATCAATCACGTTTTTCCTTTTCCTGTCG 3'
[0086] Use the primers to PCR amplify the upstream 500bp sequence of the lpxA gene of group B meningococcal strain 341215;
[0087] 1.2 According to the lpxA gene sequence of Escherichia coli DH5α strain, design synthetic primers as follows:
[0088] 5'AAGGAAAAACGTGATTGATAAATCCGCC 3'
[0089] 5'TATGGCTCATTTAACGAATCAGACCGCG 3'
[0090] Using the primers to PCR amplify the lpxA gene of Escherichia coli DH5α strain;
[0091] 1.3 According to the kanamycin resistance gene sequence on the pET28a plasmid, design synthetic primers as follows:
[0092] 5'GATTC...
Embodiment 2
[0107] Example 2: Extraction of group B meningococcal low endotoxin mutant strain OMV
[0108] 2.1 Cultivation of group B meningococcal low endotoxin mutant strains
[0109] Spread and inoculate the low-endotoxin mutant strain of group B meningococcus frozen at -70°C on 10% sheep blood ordinary agar medium, at 37°C, 5% CO 2 Incubate overnight. Scrape the bacterial lawn and inoculate it into the nutrient broth medium, cultivate it at 37°C and 180rpm for 4-6 hours, and gradually expand the culture in 30L, 100L, and 500L fermenters until the OD value is about 6-12, and add a final concentration of 0.01-0.1ug / ml of sodium deoxycholate solution sterilized for 5-20 minutes.
[0110] 2.2 Extraction of group B meningococcal low endotoxin mutant strain OMV
[0111] Take the fermented bacteria liquid and collect the bacteria by centrifugation in a disc centrifuge, suspend the bacteria in 50mM PB, 1mM Na2·EDTApH7.2 solution 5-10 times, and then homogeneously crush 2-3 times at 1000-1...
Embodiment 3
[0112] Embodiment 3: Preparation of fHbp-A recombinant lipoprotein
[0113] 3.1 Construction of fHbp-A / BL21(DE3) engineering bacteria
[0114] According to the amino acid sequence of fHbp-A, Haemophilus influenzae P4 outer membrane protein signal peptide and the codon preference of Escherichia coli, the P4 signal peptide was directly located at the N-terminus of fHbp-A, and the full-length DNA sequence was designed and synthesized on plasmid pUC57;
[0115] The pUC57 synthetic plasmid was treated with restriction endonucleases NdeI and XhoI to obtain a large fragment of (p4)fhbp-A gene.
[0116] Treat the pET43.1a plasmid with restriction endonucleases NdeI and XhoI to obtain the digested plasmid pET43.1a, such as figure 2 .
[0117] The treated target gene fragment (P4) fHbp-A and plasmid pET43.1a were ligated with a recombinase, and the ligated product was transformed into E.coli DH5α, and cultured overnight at 37°C. Positive clones were picked and inoculated in LB (Amp) l...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com