Method for identifying agaricus bisporus homonuclear sterile monospore strain and mating type thereof and primer

A technology of Agaricus bisporus and nuclear sterility, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of inability to determine the mating type of monosporus strains, tedious process, time-consuming and labor-intensive, etc.

Active Publication Date: 2018-10-02
SHANGHAI ACAD OF AGRI SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This process is tedious, time-consuming and labor-intensive, and cannot determine the mating type of the obtained monospore strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying agaricus bisporus homonuclear sterile monospore strain and mating type thereof and primer
  • Method for identifying agaricus bisporus homonuclear sterile monospore strain and mating type thereof and primer
  • Method for identifying agaricus bisporus homonuclear sterile monospore strain and mating type thereof and primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: A kind of method for identification of Agaricus bisporus synkaryotic sterile monosporus strain and its mating type

[0026] Based on the molecular marker technology, the invention establishes a simple and fast method for identifying the Agaricus bisporus synkaryotic sterile monospore strain and its mating type.

[0027] The present invention is based on the A factor sequence of the mating type gene of Agaricus bisporus, and performs PCR amplification on the characteristic fragment of the mating type gene of Agaricus bisporus, the amplification primers are Seq.No.1 and Seq.No.2, and the amplification is obtained The lengths of the characteristic fragments in the monokaryon of different mating types are 737bp and 730bp respectively, and the length of 737bp is named A + Factor, whose sequence is shown in Seq.No.4; the one with a length of 730bp is named A - Factor, its sequence is shown in Seq.No.3;.

[0028] A of two monokaryons + and A - Sequence alignm...

Embodiment 2

[0055] Embodiment 2: A kind of method for identification of Agaricus bisporus synkaryotic sterile monosporus strain and its mating type

[0056] High-fidelity enzymes pfu, dNTPs, and enzyme Buffer were purchased from Beyond Biotechnology Co., Ltd., endonucleases EcoRV and XhoI were purchased from Dalian Baosheng, and specific primers ABA1F1: ATCGTCGCAAGGGTAGGTAAGA and ABA1R1: ATTTACTGAGCCGTCGGAAGAG were purchased from Shanghai Sangon Biotechnology Co., Ltd.

[0057] Agaricus bisporus spores were collected from the fruiting bodies of strain A15 grown by Shanghai Lianzhong Edible Fungi Cooperative. After collecting the spores on the mature fruiting bodies with a bun collector, use ddH 2 O diluted to 10 5 Concentration of the spore suspension, and then take 100μl spread on the PDA plate. Then transfer the single colony grown on the plate to the PDA plate.

[0058] The mycelium of the isolated strain was subjected to mycelial PCR, that is, a small amount of mycelium was directl...

Embodiment 3

[0064] Embodiment 3: A kind of method for identification of Agaricus bisporus synkaryotic sterile monosporus strain and its mating type

[0065] High-fidelity enzymes pfu, dNTPs, and enzyme Buffer were purchased from Beyond Biotechnology Co., Ltd., endonucleases EcoRV and XhoⅠ were purchased from Dalian Baosheng, wall-lyzing enzymes were purchased from Guangzhou Institute of Microbiology, and specific primers ABA1F1: ATCGTCGCAAGGGTAGGTAAGA and ABA1R1: ATTTACTGAGCCGTCGGAAGAG were purchased From Shanghai Sangon Biotechnology Co., Ltd.

[0066] The preparation technology of the protoplasts of the Agaricus bisporus strain As2796 strain is as follows: culture the mycelia of the Agaricus bisporus As2796 strain in liquid PDA at 25°C for 5-7 days, collect the mycelia, and digest with 1.5% lysozyme. The enzymolysis temperature is 30° C., and the enzymolysis time is 3 hours. The obtained protoplasts were washed and collected with 0.6M mannitol. The obtained protoplasts were diluted to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for identifying an agaricus bisporus homonuclear sterile monospore strain and a mating type thereof and a primer. The method comprises the following steps: extractinggenome DNA (Deoxyribonucleic Acid) of agaricus bisporus, carrying out PCR (Polymerase Chain Reaction) amplification by using a primer ABA1F1 and a primer ABA1R1, carrying out enzyme digestion on the obtained PCR amplification product by using an incision enzyme, and detecting an enzyme digestion product through 1-2% agarose gel electrophoresis; if a DNA fragment ABH1 obtained through amplificationwith a specific primer can only be subjected to incision enzyme digestion of an A<+> factor, judging that the strain is a mating type of the A<+> factor of a homonuclear sterile monospore strain; ifthe DNA fragment ABH1 obtained through amplification with the specific primer can only be subjected to incision enzyme digestion of an A<-> factor, judging that the strain is a mating type of the A<->factor of the homonuclear sterile monospore strain. The method disclosed by the invention is applied to identification on agaricus bisporus homonuclear sterile monospore strains and mating types thereof, and has the advantages of being short tin time, simple and convenient to operate, high in precision, high in mushroom yield and low in cost.

Description

technical field [0001] The invention relates to a method for identifying the homokaryotic sterile monosporus strain of Agaricus bisporus and its mating type, and belongs to the technical field of biological detection. Background technique [0002] Agaricus bisporus, the Chinese aliases are mushrooms, mushrooms, and white mushrooms. It is rich in protein, polysaccharides, vitamins, nucleotides and unsaturated fatty acids. It is not only rich in nutrition, plump and delicious, but also has low heat energy. According to the statistics of the Chinese Society of Edible Fungi, the total output of Agaricus bisporus nationwide reached more than 3.37 million tons in 2015, of which the industrial production of Agaricus bisporus reached 417 tons per day, which shows that Agaricus bisporus is becoming more and more popular among consumers in China. [0003] With the rapid development of the Agaricus bisporus planting industry, it is not only related to their advanced cultivation techno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/04C12N15/11C12R1/645
CPCC12Q1/04C12Q1/6895
Inventor 陈辉张津京汪虹黄建春王倩
Owner SHANGHAI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap