Method for identifying agaricus bisporus homonuclear sterile monospore strain and mating type thereof and primer
A technology of Agaricus bisporus and nuclear sterility, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of inability to determine the mating type of monosporus strains, tedious process, time-consuming and labor-intensive, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1: A kind of method for identification of Agaricus bisporus synkaryotic sterile monosporus strain and its mating type
[0026] Based on the molecular marker technology, the invention establishes a simple and fast method for identifying the Agaricus bisporus synkaryotic sterile monospore strain and its mating type.
[0027] The present invention is based on the A factor sequence of the mating type gene of Agaricus bisporus, and performs PCR amplification on the characteristic fragment of the mating type gene of Agaricus bisporus, the amplification primers are Seq.No.1 and Seq.No.2, and the amplification is obtained The lengths of the characteristic fragments in the monokaryon of different mating types are 737bp and 730bp respectively, and the length of 737bp is named A + Factor, whose sequence is shown in Seq.No.4; the one with a length of 730bp is named A - Factor, its sequence is shown in Seq.No.3;.
[0028] A of two monokaryons + and A - Sequence alignm...
Embodiment 2
[0055] Embodiment 2: A kind of method for identification of Agaricus bisporus synkaryotic sterile monosporus strain and its mating type
[0056] High-fidelity enzymes pfu, dNTPs, and enzyme Buffer were purchased from Beyond Biotechnology Co., Ltd., endonucleases EcoRV and XhoI were purchased from Dalian Baosheng, and specific primers ABA1F1: ATCGTCGCAAGGGTAGGTAAGA and ABA1R1: ATTTACTGAGCCGTCGGAAGAG were purchased from Shanghai Sangon Biotechnology Co., Ltd.
[0057] Agaricus bisporus spores were collected from the fruiting bodies of strain A15 grown by Shanghai Lianzhong Edible Fungi Cooperative. After collecting the spores on the mature fruiting bodies with a bun collector, use ddH 2 O diluted to 10 5 Concentration of the spore suspension, and then take 100μl spread on the PDA plate. Then transfer the single colony grown on the plate to the PDA plate.
[0058] The mycelium of the isolated strain was subjected to mycelial PCR, that is, a small amount of mycelium was directl...
Embodiment 3
[0064] Embodiment 3: A kind of method for identification of Agaricus bisporus synkaryotic sterile monosporus strain and its mating type
[0065] High-fidelity enzymes pfu, dNTPs, and enzyme Buffer were purchased from Beyond Biotechnology Co., Ltd., endonucleases EcoRV and XhoⅠ were purchased from Dalian Baosheng, wall-lyzing enzymes were purchased from Guangzhou Institute of Microbiology, and specific primers ABA1F1: ATCGTCGCAAGGGTAGGTAAGA and ABA1R1: ATTTACTGAGCCGTCGGAAGAG were purchased From Shanghai Sangon Biotechnology Co., Ltd.
[0066] The preparation technology of the protoplasts of the Agaricus bisporus strain As2796 strain is as follows: culture the mycelia of the Agaricus bisporus As2796 strain in liquid PDA at 25°C for 5-7 days, collect the mycelia, and digest with 1.5% lysozyme. The enzymolysis temperature is 30° C., and the enzymolysis time is 3 hours. The obtained protoplasts were washed and collected with 0.6M mannitol. The obtained protoplasts were diluted to...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com