Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving alpha-ketoisovaleric acid yield of Klebsiella pneumoniae, and modified strain

A technology of pneumonia bacillus and ketoisovaleric acid, applied in the field of bioengineering, can solve problems such as undiscovered, and achieve the effects of wide range of raw materials, high final product concentration and high genetic stability

Active Publication Date: 2018-09-25
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

No published reports were found on the production of α-ketoisovaleric acid by Klebsiella pneumoniae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving alpha-ketoisovaleric acid yield of Klebsiella pneumoniae, and modified strain
  • Method for improving alpha-ketoisovaleric acid yield of Klebsiella pneumoniae, and modified strain
  • Method for improving alpha-ketoisovaleric acid yield of Klebsiella pneumoniae, and modified strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] The gene recombination method is used to inactivate the acetolactate decarboxylase gene of Klebsiella pneumoniae CGMCC 1.6366 (the strain is also called TUAC01, AC01) to achieve the inactivation of acetolactate decarboxylase activity.

[0022] The strain of Klebsiella pneumoniae CGMCC 1.6366 has been disclosed in the open literature (Wei Dong, Wang Min, Shi Jiping, Hao Jian.Red recombinase assisted gene replacement in Klebsiellapneumoniae.Journal of Industrial Microbiology&Biotechnology.2012 39:1219-1226) Strains. This strain is a strain used to produce 1,3-propanediol, 2,3-butanediol, acetoin and 2-ketogluconic acid. The bacteria was isolated from the soil, and the isolation and characterization of microorganisms able to produce 1,3-propanediol underaerobic conditions. World Journal of Microbiology Biotechnology 2008, 24: 1731-1740 are described in the literature (Hao Jian, et al. Isolation and characterization of microorganisms able to produce).

[0023] 1) The acetolacta...

Embodiment 2

[0043] The gene recombination method was used to construct Klebsiella pneumoniae in which the acetolactate decarboxylase gene and the lactate dehydrogenase gene were simultaneously inactivated to achieve the simultaneous inactivation of the acetolactate decarboxylase and lactate dehydrogenase activities.

[0044] 1) Amplify the lactic dehydrogenase gene sequence of Klebsiella pneumoniae by PCR, connect it to the cloning vector by the TA cloning method, and perform DNA sequence determination.

[0045] According to the genomic information of Klebsiella pneumoniae 342, PCR primers for lactate dehydrogenase gene were designed, the upstream primer ldhA-s: AGAGCGCACAGGACCACTATCCA (shown in SEQ ID NO. 11), and the downstream primer ldhA-a: TCGGCGAGCTTATAGACCAGCGT (SEQ ID NO. 12) Shown).

[0046] Using the above primers and using Klebsiella pneumoniae CGMCC 1.6366 genomic DNA as a template, the lactate dehydrogenase gene and adjacent fragments were obtained by PCR amplification, and ligated ...

Embodiment 3

[0063] The gene recombination method was used to construct Klebsiella pneumoniae in which the acetolactate decarboxylase gene and the indole-3-pyruvate decarboxylase gene were simultaneously inactivated to realize the simultaneous activity of acetolactate decarboxylase and indole-3-pyruvate decarboxylase Inactivated.

[0064] 1) The Klebsiella pneumoniae indole-3-pyruvate gene sequence was amplified by PCR, connected to the cloning vector by the TA cloning method, and the DNA sequence was determined.

[0065] According to the genomic information of Klebsiella pneumoniae 342, PCR primers for the indole-3-pyruvate gene were designed. The upstream primer ipdC-s: GCATAGAGCCCATCTCCTGAATCGT (SEQ ID NO. 16), the downstream primer ipdC-a: ACACCGCCTTTATCACCCCCTTTCT (SEQ ID Shown in NO.17).

[0066] Using the above primers and using Klebsiella pneumoniae CGMCC 1.6366 genomic DNA as a template, PCR amplification was performed to obtain the pyruvate decarboxylase gene and adjacent fragments, wh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the alpha-ketoisovaleric acid yield of Klebsiella pneumoniae, and a modified strain. The method comprises: inactivating acetolactate decarboxylase in Klebsiella pneumoniae, or simultaneously inactivating indole-3-pyruvate decarboxylase and / or lactate dehydrogenase, wherein the Klebsiella pneumoniae inactived with the enzyme is the modified strain; andinoculating the modified Klebsiella pneumoniae in a carbon source culture medium, and carrying out fermentation culture, wherein the carbon source in the culture medium is converted into alpha-ketoisovaleric acid by the modified Klebsiella pneumoniae during the fermentation culture. According to the present invention, with the method, the exogenous gene is not introduced into the modified strain,such that the strain has high genetic stability, the final concentration of the product is high, and the range of the raw material is wide.

Description

Technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to the production of α-ketoisovaleric acid by Klebsiella pneumoniae. Background technique [0002] α-ketoisovaleric acid is also called 2-ketoisovaleric acid and ketovaline. It is an α-keto acid, which is unstable and easy to decarboxylate, resulting in few naturally occurring α-keto acids in nature. In organisms, α-keto acids generally exist only in the form of intermediates, as precursors of many substances in organisms. Alpha-ketoisovaleric acid is an important cellular intermediate metabolite. Alpha-ketoisovaleric acid is the precursor of L-valine, L-leucine and pantothenic acid synthesis. It is now used as a substitute for L-valine and L-leucine for patients with chronic kidney disease. Using α-ketoisovaleric acid as a raw material, using L-valine dehydrogenase and glucose dehydrogenase to catalyze the reaction, reductive amination can be used to synthesize L-va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P7/40C12R1/22
CPCC12N9/0006C12N9/88C12P7/40C12Y101/01027C12Y101/01028C12Y401/01005C12Y401/01074
Inventor 郝健顾金杰史吉平姜标
Owner SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More