Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Klebsiella strains and their application in river sewage and rural domestic sewage containing ammonia nitrogen

A technology of Klebsiella and strains, applied in the application field of denitrification, which can solve the problems of many reaction steps, long process flow, and low cell concentration in the denitrification process, and achieve low dissolved oxygen concentration and simple denitrification process , the effect of high cell yield

Active Publication Date: 2020-04-03
ZHEJIANG SHUANGLIANG SUNDA ENVIRONMENTAL PROTECTION CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] ① Autotrophic bacteria grow slowly, with low cell concentration and poor environmental tolerance, so the reaction time is long and the denitrification efficiency is low;
[0006] ② There are many reaction steps in the whole denitrification process, the process flow is long and complicated, the site requirements are high, the investment is large, and the operation is difficult;
[0007] ③The nitrification reaction requires a large amount of oxygen, the reaction system is greatly affected by the environment, and the impact resistance is weak

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Klebsiella strains and their application in river sewage and rural domestic sewage containing ammonia nitrogen
  • Klebsiella strains and their application in river sewage and rural domestic sewage containing ammonia nitrogen
  • Klebsiella strains and their application in river sewage and rural domestic sewage containing ammonia nitrogen

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Isolation, Screening and Characterization of Heterotrophic Nitrification-Aerobic Denitrification Strains

[0036] 1. Enrichment culture: Take 10g of Yuhang Xingqiao river sludge sample in a conical flask filled with 100ml of sterile normal saline, oscillate until the sample is completely dispersed and fully mix with sterile normal saline to prepare a bacterial suspension. Take 10ml of the bacterial suspension and transfer it to 100ml of acclimatization medium, and shake and culture at 30°C and 200r / min for 2 days. This is the first acclimatization cycle. Take 10ml of the previous culture and transfer it to the second-stage acclimatization medium, and culture it with shaking at 30°C and 200r / min for 2 days.

[0037] 2. Initial screening of bacterial strains: Take 10ml of the above-mentioned bacterial solution that has been domesticated and cultivated for 24 hours, add it to a conical flask containing 90ml of sterile normal saline, and dilute the sample to 10ml according to...

Embodiment 2

[0045] Example two denitrification bacterial strain molecular biology identification

[0046] Genomic DNA of SD3 was extracted using the Microbial Genome Extraction Kit of Hangzhou Baosai Biological Co., Ltd., and the 16S rDNA fragment was amplified using this as a template. The identified primers were 27f:AGAGTTTGATCCTGGCTCAG and 1492R:GGTTACCTTGTTACGACTT. PCR reaction system (50uL): Template DNA 1uL, 2xPCR superpfu mix 25uL, 27f and 1492R primers 1uL each, add sterile deionized water until the reaction system is 50uL. PCR program: 94°C for 5min, [94°C for 30s, 55°C for 30s, 72°C for 1min and 30s] x30 cycle, 72°C for 5min, 4°C for 5min. The recovered product after PCR purification was sent to a gene sequencing company for sequencing. The obtained 16S rDNA sequence of the SD3 strain is shown in SEQ ID NO.1. According to the homologous sequence comparison analysis of NCBI database, the SD3 strain has the closest genetic relationship with Klebsiella sp, with 100% homology, an...

Embodiment 3

[0048] Klebsiella sp. KSND-3 batch culture to investigate the ammonia oxidation rate of ammonia oxidizing bacteria at different initial concentrations. The experiment was carried out in a 250ml Erlenmeyer flask with initial pH=7.8, 30°C, 150r / min, adding culture solution and bacteria solution, and the whole reaction volume was 100ml. The concentration of NH4-N is successively set to 0mg / l, 10mg / l, 20mg / l, 50mg / l, 100mg / l, 200mg / l, 500mg / l, 1000mg / l. In order to prevent the influence of acidity produced by ammonia oxidation on bacterial activity, the culture solution contained 50mmol / L phosphate buffer. The ammonia oxidation ability of the bacterial strain was judged by measuring the removal rate of ammonia nitrogen, and the results were as follows: figure 2 As shown, if the initial concentration of ammonia nitrogen is below 100mg / L, the removal efficiency of ammonia nitrogen within 24 hours is as high as 90%; even if the initial concentration of ammonia nitrogen is as high a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a denitrification bacterial strain Klebsiella sp. KSND-3 with synchronous aerobic nitrification and denitrification performance and its preparation application. The invention also provides a Klebsiella strain and its use in river sewage and Application of domestic sewage containing ammonia nitrogen in rural areas. Because of its fast growth rate, high cell yield, low concentration of dissolved oxygen, and simultaneous nitrification and denitrification, its denitrification process is simpler, more economical and effective.

Description

technical field [0001] The invention relates to a new strain of strain Klebsiella sp. KSND-3, and the application of the strain to denitrify sewage. Background technique [0002] The rapid development of human production activities has brought more and more serious pollution to the environment. The discharge of agricultural, industrial and domestic sewage has caused serious surface water pollution, far exceeding the self-sustaining and purification capacity of the environment. A large amount of nitrogen-containing compounds in the discharged sewage can cause eutrophication of water bodies and endanger aquatic organisms and human health. Therefore, controlling the concentration of ammonia nitrogen in water body is the primary goal of environmental sewage treatment. [0003] Biological denitrification technology is currently a widely used denitrification method with high economic benefits. Traditional biological denitrification is mainly completed by the synergistic action o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20C12N1/36C12Q1/10C02F3/34C12R1/22C02F101/38
CPCC02F3/34C02F2101/38C12N1/36C12Q1/10C12N1/205C12R2001/22G01N2333/26
Inventor 郑展望张碧军金鹏谢柳
Owner ZHEJIANG SHUANGLIANG SUNDA ENVIRONMENTAL PROTECTION CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com