Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of flagellin FliC from salmonella abortus equi

A Salmonella and flagellin technology, applied in the fields of bioengineering and immunity, can solve the problems of FliC protein research and utilization of rare reports, etc., and achieve the effect of good immune protection effect, high immune protection rate and good immunogenicity.

Active Publication Date: 2018-06-29
XINJIANG AGRI UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] In view of the fact that the current research on FliC protein is mostly focused on Salmonella typhimurium and Salmonella typhimurium, and the research and utilization of FliC protein on the immunity of Salmonella equine abortus is rarely reported in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of flagellin FliC from salmonella abortus equi
  • Preparation method and application of flagellin FliC from salmonella abortus equi
  • Preparation method and application of flagellin FliC from salmonella abortus equi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: PCR amplification of FliC gene

[0043] Using the extracted genomic DNA of Salmonella equine abortus as a template, the total reaction volume was 25 μL, and the PCR conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 32 cycles, 72 ℃ for a final extension of 10 min. After the reaction, the amplified products were electrophoresed on a 1% agarose gel.

Embodiment 2

[0044] Example 2: Construction of recombinant prokaryotic expression plasmid pGEX-4T-FliC

[0045] Design primers based on the cloned and sequenced FliC gene sequence: Upstream primer: 5'-GTA GGATCC ACCAACTCCCGGTCTGACCTCGACTCCATCC -3'; downstream primer: 5'-TAA CTCGAG TATTGTAGGTTTTTACCGTCGATAGAAACAAC -3', the amplified fragment size is 840bp. The template was the genome of Salmonella equine abortus strain MS97, and the PCR conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 32 cycles, and final extension at 72°C for 10 min. The FliC gene fragment obtained by PCR amplification was used respectively Bam HI, X ho After Ⅰ digestion, it was connected into the pGEX-4T-2 vector and transformed into E. coli BL21(DE3) competent cells. The positive clones were extracted and identified by enzyme digestion, and the constructed FliC prokaryotic expression vector was identified by en...

Embodiment 3

[0046] Example 3: Expression and purification of FliC protein

[0047] Pick the correct sequenced monoclonal colonies and culture them overnight in LB (Amp+, 100 μg / mL) medium, transfer to fresh LB (Amp+, 100 μg / mL) medium the next day at 1.5%, and culture at 37 °C to OD600 Equal to about 0.5, add IPTG to a final concentration of 0.1 mmol / L, induce for 4.5 hours at 29 °C, collect the bacteria by centrifugation, break the bacteria by ultrasonication, centrifuge at low temperature to get the supernatant, and analyze the expression of the target protein in the supernatant by SDS-PAGE. The sonicated supernatant containing the GST-tagged protein was purified through a purification chromatography column, and 3 mL of elution buffer was added to the column to elute the protein to elute the target protein.

[0048] SDS-PAGE electrophoresis was performed on the induced bacterial samples and the purified protein samples. The results of electrophoresis showed that compared with the contr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and possible application of flagellin FliC from salmonella abortus equi to salmonella abortus equi immunity. Through cloning and connecting a flagellin FliC gene from the salmonella abortus equi to a prokaryotic expression vector pGEX-4T-2, a prokaryotic recombinant of a protein is obtained; the prokaryotic recombinant is transformed into engineering bacteria BL-21, and the protein is subjected to induced expression and purification; the protein has an amino acid sequence in a sequence table 1; the purified FliC recombinant protein has good immunogenicity after being used for the immunization of experimental animals, can overcome the defects of low antibody level and poor safety generated by inactivated vaccines and can be used for preparing subunit vaccines for preventing and treating equine paratyphoid infection and can be used as equine animal vaccine adjuvants, thereby having good development and application prospect.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and immunization, specifically relates to the flagellin FliC of Salmonella equine abortus and its coded amino acid sequence, and relates to a preparation method of the FliC protein derived from Salmonella equine abortus and its possible application in immunization. Background technique [0002] Equine abortive salmonellosis, also known as equine paratyphoid, is an equine zoonotic disease caused by Salmonella abortusequi (Salmonella abortusequi) and is characterized by abortion in pregnant horses. Primiparous mares and foals are most susceptible to this disease. Young foals usually showed sepsis or local inflammation after infection, while male animals showed orchitis and beard fistula (Xing Tao, 2008). The disease is one of the serious infectious diseases that harm horses. It is difficult to purify among horses. As the number of susceptible horses increases, it will cause the next outbreak ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/255C12N15/70C12N1/21C12R1/19
CPCC07K14/255C12N15/70C12N2800/101
Inventor 苏艳杨康苏玲玲
Owner XINJIANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com