A nano-multiplex PCR method for distinguishing four serotypes of avian adenovirus group I
An avian adenovirus and serotype technology, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms, which can solve the problems of tediousness, poor sensitivity, and the need for special instruments.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Synthesis of nanometer multiplex PCR primers:
[0030] According to the 4, 8a, 8b and 11 types of avian adenovirus group I typing detection primer sequences designed in Table 1, synthesize various type-specific primers; 4 types of avian adenovirus group I primers (F: 5'-CAARTTCAGRCAGACGGT-3' R: 5'-AAGAGGCCCGGGCAATGC-3'); Type 8a avian adenovirus group I primer (F: 5'- CAARTTCAGRCAGACGGT -3' R: 5'-AATGTTTGACGAGCTGATGGG -3'); type 8b avian adenovirus group I primer (F : 5'- CAARTTCAGRCAGACGGT -3'R: 5'- ATGCTGCAGCTGTTGCCGTAG -3'); Type 11 avian adenovirus group I primer (F: 5'-CAARTTCAGRCAGACGGT-3' R: 5'- ACTGCCGTCGTCTCGTCTAAG -3');
[0031] 2. Extraction of genes:
[0032] Take 4, 8a, 8b and 11 types of avian adenovirus group I standard strains (purchased from the China Veterinary Drug Administration) cell grinding solution 400μL in a 1.5mLEP tube, add 400μL chloroform, 600μL lysate, mix well and precipitate at 4°C for 10min Afterwards, centrifuge at 12000r / min for 1...
Embodiment 2
[0042] Embodiment 2, nanometer multiplex PCR specificity test:
[0043] The cDNA of Infectious Bronchitis Virus (IBV), Egg Drop Syndrome Virus (EDSV), H9 Subtype Avian Influenza Virus (AIV-H9) and Newcastle Disease (NDV) were detected by the nano-multiplex PCR method established above. Validate the specificity of the method.
[0044] Such as image 3 As shown, M: 2000 maker, 1: four serotypes of avian adenovirus group I positive sample mixture, 2: IBV, 3: EDSV, 4: AIV-H9, 5: NDV.
[0045] No bands were amplified in the test results, and only the specific bands of the four serotypes of avian adenovirus-I group were amplified, indicating that the primers had good specificity.
Embodiment 3
[0046] Embodiment 3, sensitivity test:
[0047] The positive plasmid established by the hexon whole gene of the standard strain of avian adenovirus group I of type 4, 8a, 8b and 11 was used as a template, and the 10-fold serial dilution was performed to determine the minimum detection concentration of nanometer multiplex PCR and ordinary multiplex PCR.
[0048] Such as Figure 4 As shown, multiplex PCR concentration gradient: M: 2000maker, 1: original concentration plasmid, 2: 10×10 1 1-fold diluted plasmid, 3:10×10 2 1-fold diluted plasmid, 4:10×10 3 1-fold diluted plasmid, 5:10×10 4 1-fold diluted plasmid, 6:10×10 5 1-fold diluted plasmid, 7:10×10 6 Double diluted plasmid, 8:10×10 7 Dilute the plasmid one-fold. The minimum concentration of ordinary multiplex PCR detection is: FAdV-4 is 5.14×10 7 Copy·μL -1 , FAdV-8a is 2.87×10 7 Copy·μL -1 , FAdV-8b is 1.71×10 6 Copy·μL -1 , FAdV-11 is 4.35×10 7 Copy·μL -1 .
[0049] Such as Figure 5 As shown, the concentra...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com