Production method of cellular structure tension change-based skin-color-changeable fluorescent fish

A cell structure and color-changing technology, applied in the field of fluorescent fish, can solve the problem of inability to realize multi-color fluorescent expression, and achieve the effect of increasing the interaction between mermaids, expanding the pattern, and improving the fun.

Active Publication Date: 2018-03-23
NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is of great significance to develop a method for producing fluorescent fish with variable skin color based on fluorescence energy resonance transfer te

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production method of cellular structure tension change-based skin-color-changeable fluorescent fish
  • Production method of cellular structure tension change-based skin-color-changeable fluorescent fish
  • Production method of cellular structure tension change-based skin-color-changeable fluorescent fish

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Example 1: Construction of fluorescent fish with variable skin color using eCFP and eYFP as selected protein pairs

[0087] Step 1: Amplification and acquisition of the target fragment

[0088] The selected two fluorescent proteins, eCFP and eYFP, and microfilament skeleton protein β-actin were subjected to PCR amplification (52°C, 30 cycles), and the primers were as follows:

[0089] Enhanced cyan fluorescent protein (eCFP) length 717bp

[0090] Upstream primer: pATGGTGAGCAAGGGCGAGGA

[0091] Downstream primer: pCTTGTACAGCTCGTCCATGC

[0092] Enhanced orange fluorescent protein (eYFP) length 717bp

[0093] Upstream primer: pATGGTTTCTAAAGGTGAAGA

[0094] Downstream primer: pTTTATATAATTCATCCATAC.

[0095] Actin skeleton protein (β-actin) length 1125bp

[0096] Upstream primer: ATGGATGATGATATCGCCGC

[0097] Downstream primer: CTAGAAGCATTTGCGGTGGACGA

[0098] After electrophoresis and recovery of the PCR product, 10% loading buffer was added to mix well, and then ad...

Embodiment 2

[0149] Example 2 Using fish species with more pigmentation on the body surface as materials to construct fluorescent fish with variable skin color

[0150] In this embodiment, the knockout of the zebrafish golden gene will be taken as an example for illustration.

[0151] Step 1: Construct the gRNA vector of the target sequence

[0152] Firstly, the genome sequence of the golden gene of zebrafish was found on the website of NCBI (National Center for Biotechnology Information, USA). Find the exon region and lock the target sequence as GTGCAGGAGAGGAAAGATGG.

[0153] Then, to construct the target sequence gRNA, synthesize the following primers:

[0154] gRNA-F: CACCGTGCAGGAGAGGAAAGATGG

[0155] gRNA-R: ATACCCATCTTTTCCTCTCCTGCAC

[0156] Equal volumes of primers gRNA-F and gRNA-R with a final concentration of 10 nM were mixed together (25 μL each, 50 μL total volume). On a PCR machine, perform annealing. The procedure is as follows: 98°C for 5 minutes, then naturally cool to...

Embodiment 3

[0208] Embodiment 3: culture from fertilized egg to adult fish

[0209] In this embodiment, a koi carp will be taken as an example for illustration.

[0210] Step 1: Introducing the plasmid into the fertilized egg

[0211] (1) Prepare experimental fish and injection equipment

[0212] The koi used for egg collection were taken from sexually mature broodstock in the Songpu Experimental Field of Heilongjiang Fisheries Research Institute. The microinjector is the Nissan M-4A / B type, and the glass needle is drawn into a fine tip with an aperture of 2-10 P'm with a Nissan free-fall needle puller (PP-83).

[0213] (2) Specific operation

[0214] During the carp breeding season in mid-May every year, select mature broodstock to induce spawning artificially or capture broodstock with eggs flowing in the broodstock pond, collect high-quality eggs and semen, and store them in the refrigerator (6-8°C) for later use. Take a small amount of sperm and eggs for mixed insemination, and ma...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Outer diameteraaaaaaaaaa
The inside diameter ofaaaaaaaaaa
Login to view more

Abstract

The invention provides a production method of cellular structure tension change-based skin-color-changeable fluorescent fish. The production method comprises the following steps: selecting fluorescentprotein pairs, a cytoskeletal protein and a promoter to construct a recombinant transposon vector of a skin-color-changeable fluorescent protein, wherein the fluorescent protein pairs include a bluefluorescent protein and a green fluorescent protein, a cyan fluorescent protein and an orange fluorescent protein as well as a gold fluorescent protein and a cherry red fluorescent protein; simultaneously injecting the recombinant transposon vector and Tol2 mRNA into single-cell stage fertilized eggs of fish species to be treated so as to enable a target gene to be integrated into genome; screening and identifying the fish species which can stably express skin color change so as to obtain the fluorescent fish with changeable skin color caused by cellular structure tension change under light induction. The skin of the fluorescent fish obtained based on a fluorescence energy resonance transfer technology and a gene cloning technology changes the fluorescence color under light induction and in full and hungry conditions, so that the interaction between people and the fish is increased, the interestingness is improved, and the pattern of the ornamental fish market is greatly expanded.

Description

technical field [0001] The invention relates to a production method of fluorescent fish whose epidermis changes color based on the change of cell structure tension, in particular to a method for producing a fluorescent fish whose epidermis changes color based on the change of cell structure tension by using fluorescence energy resonance transfer technology and gene cloning technology. Background technique [0002] As an ornamental species, ornamental fish has always had a wide market around the world, and fluorescent fish have amazing decorative and appreciation effects because of their bright colors, weak light or inability to use a wide range of light . Therefore, the emergence of fluorescent fish has greatly changed the pattern of the ornamental fish market. At present, due to the maturity of transgenic technology, the way to obtain fish with specific traits has changed from the slow change originally caused by traditional hybridization technology to the ability to obtai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/89A01K67/027C12N15/85
CPCA01K67/0275A01K2217/075A01K2227/40A01K2267/02C12N15/85C12N15/89
Inventor 王雨轩郭军生茂正孔敏马佳蕊邱珂蔡雨婷
Owner NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap