Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Attenuated, brightened and replication-controllable HSV recombinant virus, preparation method and applications thereof

A technology for recombining viruses and viral genomes, applied in the directions of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of high toxicity and weak sensitivity, and achieve the effect of reducing toxicity and widening the host range.

Inactive Publication Date: 2018-01-26
WUHAN INST OF PHYSICS & MATHEMATICS CHINESE ACADEMY OF SCI
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, currently there are few H129 tool viruses that can be used for loop tracing, and there are generally problems such as high toxicity and weak sensitivity. It is necessary to establish an anterograde transmonosynaptic HSV tracing system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Attenuated, brightened and replication-controllable HSV recombinant virus, preparation method and applications thereof
  • Attenuated, brightened and replication-controllable HSV recombinant virus, preparation method and applications thereof
  • Attenuated, brightened and replication-controllable HSV recombinant virus, preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] TK knockout, targeted shuttle plasmid carrying exogenous genes flexibly, its construction method is as follows:

[0055] In order to construct a recombinant virus with a deletion of the TK gene, firstly, according to the H129 genome sequence queried by NCBI (GenBank: GU734772.1), primers were designed to clone the homology arm sequences on both sides of the TK gene, without retaining any TK CDS sequence. Select and clone the upstream homology arm sequence 1465bp, and the downstream homology arm sequence 1476bp.

[0056] Extract and purify HSV-1H129 virus genomic DNA, use it as a template, such as figure 1 As shown, the cloned upstream homologous arm fragment is 1465bp, and the primers used are UHAS-F: 5'GCTAGCAGTGGGCCAAAAAGCCTAGC 3'; UHAS-R: 5'AAGCTTACGCACGGGTGTTGGGTCGTTTG 3'; the cloned downstream homologous arm fragment is 1476bp long, and the primers used are DHAS-F: 5'AAGCTTGTTCGAGGCCACACGCGTCAC 3'; DHAS-R: 5'CTCGAGGGGAAAGTCCGTGATGGTGC 3'; Due to the high GC conten...

Embodiment 2

[0059] Cloning of high-abundance expression cassettes of exogenous genes and construction of insertion targeting vectors, the steps are as follows:

[0060] The exogenous gene expression cassette is inserted into the targeting vector containing the homology arm sequence through the multiple cloning site linker. In order to achieve high-abundance expression of exogenous genes, the promoter selects the ubiquitin promoter that efficiently initiates transcription. The ubiquitin system widely exists in eukaryotes, and the ubiquitin promoter in its gene family can significantly enhance the long-term expression of genes , stability, and basically not limited by tissue cells. At the same time, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) was introduced downstream of the gene ORF. WPRE can stabilize RNA and significantly enhance the expression ability of foreign proteins. In order to prepare H129tracer for tracing neural circuits, the fluorescent report...

Embodiment 3

[0064] Acquisition of HSV recombinant virus with attenuated brightening and controllable replication:

[0065] Extract the targeting shuttle vector pH129ΔTK-hUbC-EGFP-WPRE-PA or pH129ΔTK-hUbC-tdTomato-WPRE-PA, and co-transfect HEK 293T cells with the extracted H129 virus genome after digestion and linearization, and change the medium after 6 hours to contain 2% fetal bovine serum maintenance medium; observe that all cells become round and lesions (generally 24-48 hours after infection), collect the samples and place them in a -80°C refrigerator; after three times of repeated freezing and thawing, centrifuge at 6500g for 10 minutes to remove cell debris, Take 10 μl of virus supernatant to infect Vero cells, and observe whether the infected cells have fluorescent expression after 1 day to determine whether the new virus is successfully recombined; later, take the recombined virus supernatant and infect Vero cells after continuous 10-fold gradient dilution, and spread agar after 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses attenuated, brightened and replication-controllable HSV recombinant virus, a preparation method and applications thereof. According to the present invention, thymidine kinase (TK) gene essential for replicating viruses in neurons and being a main virulence factor is knocked out by using a homologous recombination method, and subsequently a red or green fluorescent gene enhancement expression cassette is recombined into the genome of the virus to construct a series of novel recombinants viruses, wherein the toxicity is markedly low, the states of infected mice are good,the fluorescence signal is strong, and the expression of the recombinant viruses is limited at the injection site after the recombinant viruses are used in in-vivo animal center labeling; by combiningwith Cre-dependent AAV helper viruses capable of expressing TK in a compensated manner, the cell-specific transmonosynaptic loop tracing is achieved; and the recombinant HSV has wide application value in nervous system targeted gene transduction, neural network transsynaptic tracing, tumor disintegration, viral replication and pathogenesis mechanism, antiviral drug screening and other fields.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an attenuated, brightened, and controllable replication HSV recombinant virus and its preparation method and application, and relates to the construction of an AAV helper virus system that assists HSV recombinant virus to trace across a single synapse, and the Application of tool virus system in anterograde transmonosynaptic tracing of brain neural circuits, nervous system targeted gene transduction and oncolytic therapy. Background technique [0002] The brain is the most complex organ in the human body, yet we still know very little about it. It is the dream of scientists to reveal the mechanism of the brain. In 2013, the "Brain Project" of the United States and the European Union was launched successively, setting off an upsurge in brain science research. Studying the structure of neural networks is an important basis for understanding the working mechanism of the bra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/65C12N15/864
Inventor 王华东徐富强何晓斌靳森郑宁
Owner WUHAN INST OF PHYSICS & MATHEMATICS CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com