Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Riboflavin and riboflavin derivatives as cancer therapy targeted drugs and application of cancer therapy targeted drugs

A technology of riboflavin and derivatives, which is applied in the field of leading drugs and achieves the effects of being extremely easy to obtain, easy to modify and simple conditions

Inactive Publication Date: 2017-12-15
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In DNA, the G-T base stabilizes the structure in the form of imine proton-carbonyl hydrogen bonds; during the replication process, the rate of G-T mismatches catalyzed by the polymerase and the probability of G-T replication errors are much higher than other types of mismatches; replication Misproduced G-T mismatches and G-T mismatches produced by deamination of 5'-methylcytosine are difficult to distinguish from other normal pairs in the gene and cannot be quickly recognized and repaired

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Riboflavin and riboflavin derivatives as cancer therapy targeted drugs and application of cancer therapy targeted drugs
  • Riboflavin and riboflavin derivatives as cancer therapy targeted drugs and application of cancer therapy targeted drugs
  • Riboflavin and riboflavin derivatives as cancer therapy targeted drugs and application of cancer therapy targeted drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 refers to appended figure 1 Design the DNA sequence containing G-T as an incomplete complementary sequence of 26 nucleotides

[0039] DNA sequence containing T (D-t):

[0040] 5'-3': ATATATACTGATCCTCTATATATATAT

[0041] DNA sequence containing G (D-g):

[0042] 5'-3': ATATATATATAGGGATCAGTATATAT

[0043] Sequence (D-a) completely complementary to D-t:

[0044] 5'-3': ATATATATATAGAGATCAGTATATAT

Embodiment 2

[0045] The radioactive isotope of embodiment 2 sequence D-t 32 P mark

[0046] 10μl reaction system includes 10uM D-t, 50mM Tris-HCl (pH 7.8), 40mM NaCl, 10mM MgCl 2 ,1mg / mL BSA,10μCiγ- 32 P ATP and 10U T4 polynucleotide kinase were reacted at 37°C for 1 hour. Purified by polyacrylamide gel electrophoresis 32 D-t after P marking.

Embodiment 3

[0047] Example 3 Riboflavin Causes Specific Single-Strand Breaks in Double-Stranded DNA Containing G-T Mismatches After Illumination

[0048] The 15 μl reaction system included 100 mM phosphate buffer, 0.4 M labeled D-t, 1 μM D-g, and 200 μM riboflavin. The reaction tube was placed at a constant temperature of 37° C., and a 45W LED lamp was placed at a distance of 15 cm from the reaction tube for 1 hour. The samples were recovered, and the reaction results were analyzed by polyacrylamide gel electrophoresis. attached figure 2 As a result of the reaction, only double strands containing G-T will undergo single-strand breaks after adding riboflavin and light.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of drug lead and discloses an application of riboflavin and riboflavin derivatives to specific triggering of DNA single-strand breaking for the first time. Riboflavin and the riboflavin derivatives can specifically recognize G-T mismatch in double-stranded DNA and trigger specific breaking of single-strand loci of DNA under illumination. The invention further discloses riboflavin and the riboflavin derivatives as cancer therapy targeted drugs and an application of the cancer therapy targeted drugs. Riboflavin and the riboflavin derivatives can result in breaking of genomic DNA in cancer cells without a high-level mismatch repair system for G-T mismatch, and finally, death of the cancer cells is caused. Riboflavin and the riboflavin derivatives are economical, safe, low-toxic and free of side effects when taken as cancer therapy drugs and applied to cancer targeted therapy.

Description

technical field [0001] The present invention relates to the field of leading drugs, relates to cancer targeting drugs and their applications, and specifically relates to new cancer targeting therapy drugs - riboflavin and its derivatives and complexes connected with non-targeting cancer drugs, and their role in cancer applications in targeted therapy. Background technique [0002] One of the problems in cancer treatment is selectivity and specificity. Currently, commonly used drugs for cancer treatment often have unclear targets, non-single action sites, and high specificity. During the treatment process, normal cells are severely damaged, and severe Side effects, increasing the burden on patients. Therefore, it is urgent to find a therapeutic drug that can specifically kill cancer cells without affecting normal cells. [0003] In DNA, the G-T base stabilizes the structure in the form of imine proton-carbonyl hydrogen bonds; during the replication process, the rate of G-T ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/525A61K41/00A61P35/00
CPCA61K31/525A61K41/0042
Inventor 唐卓袁奕董娟
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More