Riboflavin and riboflavin derivatives as cancer therapy targeted drugs and application of cancer therapy targeted drugs
A technology of riboflavin and derivatives, which is applied in the field of leading drugs and achieves the effects of being extremely easy to obtain, easy to modify and simple conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1 refers to appended figure 1 Design the DNA sequence containing G-T as an incomplete complementary sequence of 26 nucleotides
[0039] DNA sequence containing T (D-t):
[0040] 5'-3': ATATATACTGATCCTCTATATATATAT
[0041] DNA sequence containing G (D-g):
[0042] 5'-3': ATATATATATAGGGATCAGTATATAT
[0043] Sequence (D-a) completely complementary to D-t:
[0044] 5'-3': ATATATATATAGAGATCAGTATATAT
Embodiment 2
[0045] The radioactive isotope of embodiment 2 sequence D-t 32 P mark
[0046] 10μl reaction system includes 10uM D-t, 50mM Tris-HCl (pH 7.8), 40mM NaCl, 10mM MgCl 2 ,1mg / mL BSA,10μCiγ- 32 P ATP and 10U T4 polynucleotide kinase were reacted at 37°C for 1 hour. Purified by polyacrylamide gel electrophoresis 32 D-t after P marking.
Embodiment 3
[0047] Example 3 Riboflavin Causes Specific Single-Strand Breaks in Double-Stranded DNA Containing G-T Mismatches After Illumination
[0048] The 15 μl reaction system included 100 mM phosphate buffer, 0.4 M labeled D-t, 1 μM D-g, and 200 μM riboflavin. The reaction tube was placed at a constant temperature of 37° C., and a 45W LED lamp was placed at a distance of 15 cm from the reaction tube for 1 hour. The samples were recovered, and the reaction results were analyzed by polyacrylamide gel electrophoresis. attached figure 2 As a result of the reaction, only double strands containing G-T will undergo single-strand breaks after adding riboflavin and light.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap