Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rhizopus oryzae ljh3 and its application in biotransformation of sophoroside to prepare genistein

A technology of Rhizopus oryzae and sophoridoside, which is applied in Rhizopus oryzae LJH3 and in the application field of biotransformation of sophoridoside to prepare genistein, which can solve the problem that the mother nucleus structure is easily destroyed, the industrial application is difficult, and the substrate feeding Low concentration and other problems, to achieve the effects of low production cost, low environmental pollution, and high concentration of substrate feeding

Active Publication Date: 2020-05-26
ZHEJIANG UNIV OF TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, existing enzymatic conversion research reports, such as the hydrolysis process of soybean isoflavones hydrolyzed by β-glucosidase, when the concentration of soybean isoflavones is 0.5mmol / L, the hydrolysis rate of genistein can reach 94.2% (Zhang Yongzhong, Li Muzi, Sun Yanmei, et al. "Amano" β-glucosidase hydrolysis technology of soybean isoflavones. Food Science, 2008,29(5):254-258.), but this method uses commercial grade β-glucosidase produced in Japan , the cost is undoubtedly high, and the concentration of the substrate is low, so there are certain difficulties in industrial application; if the acid hydrolysis method is used, the structure of the parent nucleus is easily destroyed, and more by-products are produced, resulting in low product yields. Separation and purification Difficulty and other issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rhizopus oryzae ljh3 and its application in biotransformation of sophoroside to prepare genistein
  • Rhizopus oryzae ljh3 and its application in biotransformation of sophoroside to prepare genistein
  • Rhizopus oryzae ljh3 and its application in biotransformation of sophoroside to prepare genistein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Isolation and screening of embodiment 1 transformed strain

[0033] Crush the Chinese medicinal material Huaijiao through a 60-mesh sieve, put 10g of Huaijiao powder in a conical flask, add a small amount of sterile water to moisten it, and incubate at a constant temperature of 28°C for 4 days, then add 90mL of sterile water to make a suspension, dilute 1×10 6 Spread on potato dextrose agar plate medium (PDA) after doubling, culture at 28°C for 4 days, pick fungal colonies with different colors and shapes and transfer to fresh PDA plate medium, place at 28°C for 3 days to obtain spores Ten abundant strains (see Table 1 for strain numbers) were stored in a 4°C refrigerator for later use.

[0034] Pick 2 rings of spores from the plate culture medium of each of the above-mentioned strains, inoculate into 100mL initial fermentation medium (250mL Erlenmeyer bottle), shake culture at 30°C and 200r / min for 5 days, and add 1mg of sophorin Dissolve in 1 mL, 0.1 mol / L NaOH aqueo...

Embodiment 2

[0045] Example 2: Stability Verification of Transformation of Bacterial Strain LJH3

[0046] Using the strain LJH3 as the transformed strain, the fermentation broth was prepared in a 100mL shake flask fermentation scale, and the fermentation broth containing the bacteria was used to transform sophoricroside to verify the transformation stability of the strain. The specific process steps are as follows:

[0047] (1) Inoculate the bacterial strain LJH3 plate bacterial classification preserved in 4 ℃ of refrigerators on fresh PDA plate culture medium, plate is cultivated at 30 ℃ constant temperature 2d, and described PDA plate medium composition and preparation method are the same as embodiment 1;

[0048] (2) Use an inoculation loop to pick up the step (1) After the activation culture, the spores of the strain LJH3 were inoculated twice into 100 mL of the initial fermentation medium, and cultured for 5 days at 30 ° C and 200 r / min constant temperature shaking conditions to obtain...

Embodiment 3

[0051] Example 3: Classification and Identification of Bacterial Strain LJH3

[0052] The LJH3 strain was inoculated on potato agar plate medium and cultured in an incubator at 30°C for 3 days. The colonies were dense, white at first, and then turned grayish brown or dark brown. Shaped or root-like, brown; cyst peduncles erect or slightly curved, opposite to rhizoids, sometimes enlarged or branched, brown; cyst axis spherical or subspherical or oval, light brown.

[0053] The strain LJH3 was submitted to Sangon Bioengineering (Shanghai) Co., Ltd. for 18S rDNA sequencing, and the measured sequence size was 600bp. The specific sequence (shown in SEQ ID NO: 1) is as follows:

[0054] CGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGCACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kind of Rhizopus oryzae LJH3 and its application in the preparation of genistein by biotransforming sophoraside. The application is the fermented liquid obtained by fermenting and cultivating Rhizopus oryzae LJH3, or the fermented liquid is filtered to remove bacteria. The mixture of the filtrate of the body and the equal volume of distilled water is used as a biocatalyst, and the transformation system is formed with sophorin as the substrate. The transformation reaction is carried out at 30-38°C and 200-250r / min constant temperature oscillation. After the transformation reaction is completed, The conversion liquid is separated and purified to obtain genistein; in the present invention, when the substrate feeding concentration is 1 g / L, the conversion yield of genistein is 84.2%, and the purity is 92.5%. The invention converts low-activity sophorin into genistein with better activity, which is an optional production method for producing genistein. The process has the advantages of low production cost, high conversion rate, and small environmental pollution.

Description

[0001] (1) Technical field [0002] The invention relates to a method for preparing genistein through biotransformation of sophorin as raw material. [0003] (2) Background technology [0004] Genistein (genistein) is also known as genistein, genistein and genistein, etc., the chemical name is 5,7,4′-trihydroxy isoflavone (CAS number is 446-72-0, molecular formula is C 15 h 10 o 55 , with a molecular weight of 270.24), belonging to isoflavones. Genistein has estrogen-like effects, and has anti-inflammatory, anti-fertility and osteoporosis prevention effects. In recent years, many scholars have studied the biological activity of genistein and found that it also has anti-oxidation, hypolipidemic , anti-tumor and prevention of osteoporosis and other biological activities. [0005] Genistein exists in some leguminous plants in a free state, such as Sophora japonica, soybean, pueraria, bean root and gorse, so it can be isolated from these plants, but its content is relatively lo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C12P17/06C12R1/845
CPCC12N1/14C12P17/06C12N1/145C12R2001/845
Inventor 梅建凤刘姜华应国清易喻陈建澍张彦璐
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com