Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cargo plasmid as well as construction and application method of cargo plasmid

A construction method and plasmid technology, applied in biochemical equipment and methods, using vectors to introduce foreign genetic material, vectors, etc., to save test time and operation links, save test and time, and reduce test costs

Inactive Publication Date: 2017-06-13
TSINGHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, the commonly used Geteway and Cre-loxP recombination strategies require special recombination sites

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cargo plasmid as well as construction and application method of cargo plasmid
  • Cargo plasmid as well as construction and application method of cargo plasmid
  • Cargo plasmid as well as construction and application method of cargo plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] In the following examples, the enzymes used were purchased from NEB, Anabaena 7120 was purchased from the Institute of Hydrobiology, Chinese Academy of Sciences, the sequence information of GFP and kan came from the NCBI database, the primers were synthesized by Jinweizhi, and the three-parent transformation plasmid (pRL271 / pRL623 / pIncP) Presented by Professor Wolk.

[0043] refer to Figure 2a-2b Obtain universal plasmid and carrier plasmid through this process for the present invention, exemplary process is as follows:

[0044] Mix 300 ng of DNA of vector plasmid pRL271 with 0.5 μl of restriction endonuclease Xho I, perform enzyme digestion, bathe in water at 37° C. for 1 hour, and obtain linearized vector fragment L-pRL271 after recovery. Using Anabaena 7120 genomic DNA as a template, using pt-up-1 (SEQ ID No: 9) and pt-up-2 (SEQ ID No: 10) as primers to amplify the upstream fragment of homologous recombination double exchange (SEQ ID No :3); using pt-down-1 (SEQ I...

Embodiment 2

[0051] Using the total genomic DNA of Houttuynia cordata 7120 as a template, the upstream and downstream primers of fragment 1 and the upstream and downstream primers of fragment 2 were used for PCR reaction. Reaction program: pre-denaturation at 98°C for 5 minutes; deformation at 98°C for 10 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min. The primer sequences are as follows:

[0052] Fragment one upstream primer:

[0053] CAGGTTAGGAGAACGCCGTCGACATGGCTAGCTACCAAGTTAG (SEQ ID No: 21)

[0054] Fragment one downstream primer:

[0055] CTGGATTCTGAGGCATGGTACCAGCAAGGTACGGTTC (SEQ ID No: 22)

[0056] Fragment 2 upstream primer:

[0057] CTGGTACCATGCCTCAGAATCCAGAAAG (SEQ ID No: 23)

[0058] Fragment 2 downstream primer:

[0059] CCAATATTTTTAATGATTTCAAGTCTAGACTAGCGGATCAAGTCAAAG (SEQ ID No: 24)

[0060] The two obtained fragments were connected into one fragment by fusion PCR method (denature the above-mentioned fragment 1 and f...

Embodiment 3

[0063] Cultivate wild-type and FdnifK strains until grown to OD 730 ≈0.8, divide the algae solution into 40ml to 60ml glass tubes, fill the glass tubes with argon to remove the air, seal them with rubber stoppers, and place them under light for cultivation. Hydrogen was determined by gas chromatography. The accumulation of hydrogen gas as Figure 4 As shown, the FdnifK strain can significantly increase the H 2 output.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction of a cargo plasmid in an anabaena 7120 triparental transformation system and application method of the cargo plasmid. The plasmid pPT27 is formed by recombining nucleic acid elements in one step through a sequence and linkage independent cloning (SLIC) method. After a target nucleic acid sequence is connected, the cargo plasmid is generated, and the cargo plasmid and helping and combination plasmids are used for transferring an exogenous DNA (Deoxyribonucleic Acid) sequence into a host cell; a target mutant strain is screened through a marker gene. The invention further discloses the application method of the pPT27 plasmid, and green fluorescent protein (GFP) and fused protein (FdnifK) are transferred in. The cargo plasmid (pPT27) constructed by the invention can be used for functional analysis and protein expression of a target DNA segment; the cargo plasmid can be rapidly and efficiently constructed in a time-saving manner by applying the constructed plasmid and limitation on a DNA sequence can be avoided; the cargo plasmid has very important meanings in the aspect of researches of gene functions.

Description

technical field [0001] The invention discloses a construction and application method of a carrying plasmid in an Anabaena 7120 three-parent transformation system, and belongs to the technical field of cloning in genetic engineering. Background technique [0002] In Anabaena 7120, the mutant strains of important genes could not be obtained, so the physiological phenotype of overexpressed strains could reflect the functions of unknown genes. The three-parent transformation method (Wolk et al., Construction of shuttle vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous cyanobacteria, Proc.Natl.Acad.Sci.U.S.A., 1984; Javier et al. .Role of a Microcin-C-likebiosynthetic gene cluster in allelopathic interactions in marine Synechococcus, Proc.Natl.Acad.Sci.U.S.A., 2013; Jeff et al.Reduction of conjugaltransfer efficiency by three restriction activities of Anabaena sp.20JStrain PCC.7 Bacteriol., 1997). The triparental transformation method ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N15/65
CPCC12N15/65C12N15/74C12N2800/101
Inventor 李十中张治宇仉磊
Owner TSINGHUA UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More