Nitrilase mutant as well as coding gene and application thereof

A nitrilase and mutant technology, applied in the fields of hydrolase, application, genetic engineering, etc., can solve the problems that levoketoprofen has no pharmacological activity and ketoprofen lacks chiral selectivity, etc., and achieves high enzyme activity and/or Or stereoselectivity, reduce production cost, improve production efficiency

Active Publication Date: 2017-05-10
HEC PHARMA CO LTD +1
View PDF9 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the process route of chemical synthesis of ketoprofen is very mature, but the synthetic ketoprofen lacks chiral selectivity
Because levoketoprofen has no pharmacological activity and has great side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nitrilase mutant as well as coding gene and application thereof
  • Nitrilase mutant as well as coding gene and application thereof
  • Nitrilase mutant as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Cloning of embodiment 1 wild-type nitrilase gene

[0071] (1) Acquisition of wild-type nitrilase gene

[0072] A strain of Alcaligenes faecalis HEC-AF001 was screened from the soil near industrial wastewater. The total genomic DNA was extracted using the OMEGA bacterial genome kit, and a gene fragment of about 1.1 kb in length was amplified using the following primers.

[0073] HEC-AF001-F: CCCATATGCAGACAAGAAAAATC (SEQ ID NO: 17)

[0074] HEC-AF001-R: CCAAGCTTTCAGGACGGTTCTTG (SEQ ID NO: 18)

[0075] The PCR reaction system is shown in Table 1

[0076] Table 1

[0077] Element System (μl) 5×PrimeSTAR PCR HS Buffer 10 Primer 1 1 Primer 2 1 Template (<0.2μg)

1 dNTPs (2.5mM) 4 PrimeSTAR PCR HS Polymerase 0.5 wxya 2 o

50

[0078] PCR amplification program: 98°C, pre-denaturation for 20s; 98°C, denaturation for 10s; 60°C for 10s; 72°C for 60s; repeat 30 cycles; 72°C for 10 minutes.

[0079] The PCR product w...

Embodiment 2

[0081] Embodiment 2 Preparation of recombinant expression plasmid and recombinant expression transformant

[0082] The PCR product obtained in Example 1 was double-digested with restriction endonucleases NdeI and HindIII at 37°C for 4 h, purified by agarose gel electrophoresis, and the target fragment was recovered using an agarose gel DNA recovery kit, which contained the correct Insert snippet. The target fragment was mixed with the plasmid pET28a digested with NdeI and HindIII, and ligated at 16°C for 4 hours under the action of T4 DNA ligase to obtain the recombinant expression plasmid pET28a-NIT1.

[0083]The above recombinant expression plasmids were transformed into E.coli Top10 competent cells. On the resistant plate containing kanamycin (medium composition LB medium, peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L and agar 2%, antibiotic content 50mg / L) Screening was carried out, single clones were picked, and recombinant strains were cultivated. After plas...

Embodiment 3

[0084] Expression of embodiment 3 recombinant nitrilase

[0085] The recombinant Escherichia coli obtained in Example 2 was inoculated into LB medium containing kanamycin (50 mg / L), and cultured with shaking at 37° C. overnight. According to the inoculum amount of 2‰ (v / v), insert into the 250ml Erlenmeyer flask that 50ml LB culture medium is housed, put 37 ℃, 180rpm shaker shaking culture. When the OD of the culture medium 600 When it reaches 0.8, add IPTG with a final concentration of 0.5mmol / L for induction. After induction at 30°C for 8 hours, the culture medium was centrifuged to collect the cells to obtain 0.3 g of wet cells.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a nitrilase mutant and in particular relates to a nitrilase mutant and a coding gene thereof as well as application of the nitrilase mutant to preparation of optical activity 2-aryl propionic acid (2-APA). The mutant comprises an amino acid substitution on any one or more amino acid sites in an amino acid sequence shown as SEQ ID NO: 1, and the sites are 135, 41, 192 and 120. Compared with wild type nitrilase, the mutant has relatively high enzyme activity and/or stereoselectivity; according to the application of the nitrilase mutant to preparation of the optical activity 2-APA, the production cost can be reduced and the production efficiency can be improved when being compared with those of a chemical synthesis method; the requirements of industrial production are met.

Description

technical field [0001] The invention relates to a nitrilase mutant, in particular to a nitrilase mutant and its coding gene, and its application in preparing optically active 2-aryl propionic acid. Background technique [0002] In organic synthesis, cyano groups are easily introduced into organic compounds as "water-stable carbanions", while nitrile compounds are versatile intermediates that can be converted into amines, amides, carboxylic acids and carboxyl compounds, etc. When microbial enzymes are used to hydrolyze nitriles to amides and carboxylic acids, it has become a method that has attracted much attention due to mild reaction conditions and high-purity products. So far, there have been many successful examples in industrial production. In recent years, it is quite meaningful to study the preparation of optically active 2-arylpropionic acid (2-APA) by stereoselective hydrolysis of nitriles with microbial enzymes. Optically active 2-APA can be used as a drug active su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/78C12N15/55C12N15/63C12P41/00C12P7/40
Inventor 汪璞王小龙林洁鲍素敏谢文平张鸿赵裕栋吴波张向阳卢元东汪寅华李文辉何志祥
Owner HEC PHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap