Supercharge Your Innovation With Domain-Expert AI Agents!

Over-expression GhJAZ1 genes capable of enhancing low temperature stress resistance of plants

A low temperature stress and overexpression technology is applied in the application field of GhJAZ1 gene in enhancing plant low temperature stress resistance, which can solve the problems of cotton planting effects, low temperature and the like

Inactive Publication Date: 2017-03-15
HUAZHONG AGRI UNIV
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the change of cotton planting methods in my country, more and more cotton planting provinces and regions adopt direct seeding cotton planting methods. Under this cotton planting method, the probability of cotton seedlings encountering low temperature increases, which has caused serious damage to cotton planting in my country. Serious impact

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Over-expression GhJAZ1 genes capable of enhancing low temperature stress resistance of plants
  • Over-expression GhJAZ1 genes capable of enhancing low temperature stress resistance of plants
  • Over-expression GhJAZ1 genes capable of enhancing low temperature stress resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Isolation, cloning and expression pattern analysis of GhJAZ1 gene

[0043] A. RNA extraction and cDNA acquisition

[0044] The ORF, protein sequence and conserved domain of GhJAZ1 gene were obtained from NCBI (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html). Total RNA was extracted from Yuzao No. 1 upland cotton (YZ1) plant leaves, and the method of extracting total RNA was referred to the method reported by Zhu et al (2005). 2ug RNA samples were taken, and reverse transcriptase Superscript III (purchased from Invitrogen Company, U.S.) reverse-transcribed it to synthesize cDNA, and the reaction conditions were: 65° C. for 5 minutes, 50° C. for 60 minutes, and 70° C. for 10 minutes.

[0045] B. Obtaining the full-length sequence of GhJAZ1 gene

[0046] According to the ORF sequence of the GhJAZ1 gene obtained from the query, the primers GhJAZ1-F (5'-GAGCAAATAGTTGGGATTCTGG-3') and GhJAZ1-R (5'-AACTCGGCTGGGACTACTAC-3') were designed to amplify the gene, and PCR was...

Embodiment 2

[0049] Embodiment 2: Construction of GhJAZ1 gene plant overexpression vector and interference expression vector

[0050] A. Construction of overexpression vector

[0051] According to the obtained gene sequence, primers with BP-LR reaction adapters were designed to construct expression vectors. The primer sequences were OE-GhJAZ1-F (5'-GGGGACAAGTTTGTACAAAAAGCAGGCTGCGAGCAAATAGTTGGGATTCTGG-3') and OE-GhJAZ1-R (5'- GGGGACCACTTTGTACAAGAAAGCTGGGTCAACTCGGCTGGGACTACTAC-3'), T-GhJAZ1 plasmid (purchased from Promega, USA) was used as a template for PCR amplification. 1 cycle; 72°C extension for 5 min, amplified by PCR to obtain a PCR product containing the complete ORF with linker bases of BP-LR reaction at both ends. The PCR product was ligated into pDONR by BP reaction TM 221 carrier (BP enzyme was purchased from Invitrogen Company, the United States, reacted at room temperature for 4 hours, pDONR TM 221 carrier map see Figure 3C , pDONR TM 221 vector (from CSIRO Plant Industry...

Embodiment 3

[0057] Genetic transformation and screening identification of embodiment 3GhJAZ1 gene

[0058] A. Preparation of Cotton Hypocotyls

[0059] The test material was Yuzao No. 1 upland cotton (YZ1). The plump and consistent YZ1 seeds were selected, the seed coat was peeled off, and sterilized with 0.1% mercury chloride solution for 10-12 minutes. During this period, the seeds were rinsed with sterile water three times. Seeds were placed on the surface of MS medium. After 1 day of dark culture at 30°C, seedlings were supported, and dark culture was continued for 4-5 days.

[0060] B. Activation of Agrobacterium

[0061] Take out the glycerol tube of the EHA105 strain containing the target gene (i.e. the cloned GhJAZ1 gene of the present invention) stored in the ultra-low temperature refrigerator and melt it on ice, add 10 μl to 2 ml of LB liquid containing 100 mg / L spectinomycin, and culture with shaking at 28°C 1 day, add 20ul of the activated bacteria solution and 15-20ml of f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and in particular relates to over-expression GhJAZ1 genes capable of enhancing low temperature stress resistance of plants. JAZ (JASMONATE-ZIM DOMAIN) family protein genes GhJAZ1 are cloned from cotton, a cDNA sequence of the genes GhJAZ1 is shown in SEQ ID NO: 1, and the coded protein sequence is shown in SEQ ID NO: 2. An over-expression vector of the genes is constructed, and a transgenic plant is obtained according to a genetic transformation method. The cloned genes in the invention are proved to be capable of improving the tolerance of the cotton on low temperature stress.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. It specifically relates to the application of a GhJAZ1 gene in enhancing plant resistance to low temperature stress. The JAZ (JASMONATE-ZIM DOMAIN) family protein gene GhJAZ1 cloned from cotton, functional verification showed that overexpression of GhJAZ1 gene can improve the tolerance of cotton to low temperature stress. The cloned GhJAZ1 gene of the present invention can be applied to enhance the tolerance of plants to low temperature stress through genetic transformation. Background technique [0002] Low temperature stress includes cold stress (0-20°C) and freezing stress (<0°C), which will seriously affect the growth and yield of plants, and even lead to plant death in severe cases. At the same time, low temperature is also an important factor that limits the spatial distribution of plants. should affect the factor. When plants are in a cold stress environment, the no...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00
Inventor 杨细燕孙恒何昕张献龙
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More