Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Double PCR detection primer, double PCR detection reagent kit and double PCR detection method for identification of orf virus and capripoxvirus

A kind of technology of sheep pox virus and sheep pox virus, which is applied in the direction of biochemical equipment and methods, microbe measurement/testing, recombinant DNA technology, etc., can solve the problems of indistinguishable, mixed infection of sheep pox and sheep pox, etc. Quantitative, highly sensitive, and specific effects

Active Publication Date: 2016-11-09
INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the mixed infection of sheeppox and sheep's mouth is serious, and it is difficult to distinguish clinically, which brings challenges to prevention and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double PCR detection primer, double PCR detection reagent kit and double PCR detection method for identification of orf virus and capripoxvirus
  • Double PCR detection primer, double PCR detection reagent kit and double PCR detection method for identification of orf virus and capripoxvirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Primer Design

[0033] According to the genome sequences of sheep pox virus, goat pox virus, sheep pox virus and bovine pimple skin disease virus in GenBank, 2 pairs of primers were designed, among which the ORFV primer pair can cover more sheep pox virus to the greatest extent; the CaPV primer pair can amplify Goat pox virus, sheep pox virus and bovine pimple skin disease virus. Its base sequence is shown below.

[0034] ORFV-F: CATCATTGCCGTTTACCTCAGA (SEQ ID NO: 1) or CATCATTGCCGTTTACTTCAGA (SEQ ID NO: 2);

[0035] ORFV-R: TAAGATCYGTGTCGTGTATTCC (SEQ ID NO: 3) or TAAGTTCYGTGTCGTGTATTCC (SEQ ID NO: 4);

[0036] CaPV-F: CTGGAAGCAAGTGGTAACGGAATA (SEQ ID NO: 5);

[0037] CaPV-R: AACGATACGAAGGAAATGTGGG (SEQ ID NO: 6).

Embodiment 2

[0038] Example 2 Double PCR detection method

[0039] 1) Extraction of DNA

[0040] Viral nucleic acid was extracted according to the instructions of Axygen's DNA / RNA extraction kit.

[0041] 2) Double PCR amplification reaction

[0042] A double-PCR detection method was established by using the nucleic acid mixture of sheep aphthus virus and (or) sheeppox virus as the template of double-PCR. Use 50 μL PCR reaction system: 25 μL 2×Taq PCR Master Mix, 1 μL each of primers ORFV-F, ORFV-R, CaPV-F and CaPV-R, 5 μL of ORFV and CaPV templates, sterilized H 2 O 11 μL.

[0043] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 64°C for 30 s, extension at 72°C for 30 s, a total of 40 cycles; final extension at 72°C for 10 min.

[0044] Result observation: Take 30 μL of PCR products for 1.5% agarose gel electrophoresis analysis, and observe the results under the gel imaging system.

Embodiment 3

[0045] Embodiment 3 specificity test

[0046] According to the method of embodiment 2, utilize double PCR detection method to positive recombinant plasmid and Peste des Petits Ruminants virus, bovine viral diarrhea and mucosal disease virus, blue tongue disease virus, fowlpox virus, foot-and-mouth disease virus to test.

[0047] see results figure 1 . Lane M: DNA Marker 2000; 1: ORFV positive plasmid; 2: CaPV positive plasmid; 3: ORFV+CaPV positive plasmid; 4: bovine viral diarrhea and mucosal disease virus nucleic acid; 5: bluetongue virus nucleic acid; 6: small Nucleic acid of Peste ruminant disease virus; 7: Nucleic acid of fowlpox virus; 8: Nucleic acid of foot-and-mouth disease virus.

[0048] Depend on figure 1 It can be seen that the optimized double-PCR detection method was used to amplify the positive recombinant plasmids and mixtures of oral ulcer virus and sheep pox virus, and the results obtained fragments of about 600bp and 300bp in size, which were consistent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a double PCR detection primer, a double PCR detection reagent kit and a double PCR detection method for identification of orf virus and capripoxvirus. The method provides a rapid detection method for diagnosis of the orf virus and capripoxvirus. Particularly, the PCR primer for detection of the capripoxvirus relates to all the members of capripoxvirus, including goat capripoxvirus, sheep capripoxvirus, and lumpy skin disease virus, so that the detection method has the characteristics of highlight integration and high-throughput performance, etc., and can provide technical support and help for diagnosis of the orf virus and capripoxvirus, and investigation, prevention and treatment of epidemic virus. The method has the advantages of high specificity, high sensitivity and time saving and labor saving.

Description

technical field [0001] The invention specifically relates to a double PCR detection primer, a kit and a detection method for differentiating the aphthus virus and the pox virus. Background technique [0002] According to statistics, the World Organization for Animal Health (OIE) has a total of 118 new statutory animal infectious diseases that came into effect on January 1, 2016, of which 25 can infect multiple species, 14 cattle diseases, 11 sheep diseases and 11 equine diseases. , 13 kinds of poultry diseases, 6 kinds of pig diseases. According to statistics from the Center for Food Safety and Public Health in the United States, among the 118 animal infectious diseases, there are 69 zoonotic diseases, accounting for about 58.5%. Zoonotic diseases not only endanger the healthy development of the national animal husbandry, but also affect the food safety and public health safety of the people, as well as social harmony and stability. It is a hot research topic for veterinary...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 翟少伦温肖会吕殿红魏文康贾春玲周秀蓉
Owner INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com