Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plasmid standard product for detecting HLA-DP gene rs3077 locus polymorphism and preparation method thereof

A locus polymorphism, standard technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of lack of positive standards, achieve high accuracy and reduce experimental errors , the effect of high purity

Inactive Publication Date: 2016-09-21
CHENGDU ZHONGCHUANG QINGKE MEDICAL LAB CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Aiming at the above-mentioned problems in the prior art, the present invention provides a plasmid standard for detecting the polymorphism of the HLA-DP gene rs3077 site and its preparation method, which can effectively solve the problem of lack of positive standard products for this site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasmid standard product for detecting HLA-DP gene rs3077 locus polymorphism and preparation method thereof
  • Plasmid standard product for detecting HLA-DP gene rs3077 locus polymorphism and preparation method thereof
  • Plasmid standard product for detecting HLA-DP gene rs3077 locus polymorphism and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1 Designs the primers for amplifying the rs3077 site

[0034] Search the gene sequence of SNP rs3077 in the NCBI database. The base of this site is C in the wild type and T in the mutant type. The gene sequence near the SNP site is: TCTTCTCACTTCATGTGAAAACTAC[C / T]CCAGTGGCTGACTGAATTGCTGACC, see SEQ ID NO: 1 for the complete sequence , using the rs3077 gene sequence as a template, use Primer-BLAST to design primers, the target fragment size is 506bp, including the wild-type or mutant site to be detected, that is, the Y site in the sequence, and select primers with better specificity , the sequences of the forward and reverse primers are: 5′-AATAACTGTGTGTGTTGCTG-3′ and 5′-TCAATATCCTCAGACCTTTC-3′, the sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3 respectively, and then sent to Yingwei Jieji (Shanghai) Trade Co., Ltd. synthesized primers, and the synthetic primer dry powder was diluted to 5 pmol / μL with sterile deionized water, and set aside;

[0035] 10 DN...

Embodiment 2

[0038] Example 2 Screening of HLA-DP gene rs3077 site CC genotype TT genotype EDTA anticoagulated peripheral blood samples

[0039]Collection of peripheral blood: The blood samples used in the present invention are EDTA anticoagulated peripheral blood of healthy people. After informed consent of 10 subjects, they were collected in EDTA anticoagulant tubes, and each person collected 3 mL.

[0040] Extraction of peripheral blood genomic DNA: draw 500 μL each of the 10 collected peripheral blood samples, extract peripheral blood genomic DNA according to the operation instructions of the blood genomic DNA extraction kit (TIANGEN company, catalog number: DP318), and detect with ultra-trace nucleic acid protein The concentration and purity of the extracted nucleic acid were detected by a BioDrop instrument, and the extracted DNA samples were stored at -20°C for later use.

[0041] Amplification comparison: 10 samples of peripheral blood genomic DNA were amplified by PCR. The reactio...

Embodiment 3

[0042] Example 3 Construction of plasmid standards containing the CC and TT genotypes of the rs3077 site of the HLA-DP gene

[0043] 1. Extraction of CC type and TT type DNA and amplification of target fragments: the CC type and TT type blood samples screened out are subjected to DNA extraction and PCR amplification (extraction process and PCR amplification process are the same as in Example 2), Then carry out agarose gel electrophoresis, cut out the agarose gel containing the target fragment (506bp) in the gel imager operating table, then use the recovery purification kit (TIANGEN company) to recover and purify the agarose gel DNA fragment, Collect the purified product for later use.

[0044] ② Ligation and transformation: Ligate the purified product with pGM-T Vector, melt the vector on ice, and make a total reaction system of 10 μL: 3 μL target PCR fragment, 1 μL pGM-T Vector, 1 μL 10×T4 DNA Ligation Buffer, 1 μL T4DNA Ligase, 4 μL wxya 2 O, ligate overnight at 16°C; take...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a plasmid standard product for detecting HLA-DP gene rs3077 locus polymorphism. A preparation method of the plasmid standard product comprises the following steps of (1) designing primers of an HLA-DP gene rs3077 locus, wherein the sequences of forward and reverse primers are respectively 5'-AATAACTGTGTGTGTTGCTG-3' and 5'-TCAATATCCTCAGACCTTTC-3'; (2) selecting EDTA (Ethylene Diamine Tetraacetic Acid) anti-coagulation peripheral blood specimens of the CC genotype and TT genotype of the HLA-DP gene rs3077 locus; and (3) building plasmid standard products including three different genotype target fragments of the HLA-DP gene rs3077 locus. The standard product has the advantages that the purity is high; the cost is low; the storage is easy; the accuracy is high; the specificity and the stability are good; and experiment errors can be reduced, and the like. The plasmid standard product can be used for HLA-DP gene rs3077 locus polymorphism detection for a long time.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a plasmid standard product for detecting the polymorphism of HLA-DP gene rs3077 site and a preparation method thereof. Background technique [0002] Cervical cancer has been listed as the second most malignant tumor that threatens women's lives, and its incidence rate is second only to breast cancer. There are about 500,000 new cases worldwide every year. The occurrence of cervical cancer is a complex process with multiple factors and multiple stages. In recent years, many studies have shown that HLA gene polymorphisms are closely related to the genetic susceptibility of cervical cancer. Human leukocyte antigen (Human Leukocyte Anti-gen, HLA), as the core molecule of the body's adaptive immunity, plays an important role in the clearance of HPV infection and the occurrence and development of cervical cancer. HLA genes are divided into three categories: HLA class I gene re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6806C12Q2600/166
Inventor 李晓瑞张蓉邓银林秀芳刘月
Owner CHENGDU ZHONGCHUANG QINGKE MEDICAL LAB CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com