Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of attenuated vaccine against classical swine fever virus with molecular markers

A swine fever virus and attenuated vaccine technology, applied in the direction of virus, antiviral agent, virus/phage, etc., can solve the problems of low antibody level, hidden danger of biological safety, difficulty in differential diagnosis, etc., and achieve the effect of good genetic stability

Active Publication Date: 2019-10-29
ZHEJIANG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the vaccine has certain defects: after the vaccine is immunized, it cannot distinguish whether the induced antibodies are from immunized animals or from wild virus infection.
However, because its skeleton is BVDV, the level of antibodies against BVDV Erns after immunization is low, and the differential diagnosis is still difficult. Secondly, the level of cellular immunity after immunization may not be as good as that of C-Strain, so it cannot be used for emergency immunization. Finally, the inserted E2 gene belongs to The virus strain is not prevalent in China, and there is a great biological safety hazard in the introduction. Therefore, it is imminent to develop and develop a new molecular marker vaccine suitable for the actual situation of swine fever epidemic in my country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of attenuated vaccine against classical swine fever virus with molecular markers
  • Construction method of attenuated vaccine against classical swine fever virus with molecular markers
  • Construction method of attenuated vaccine against classical swine fever virus with molecular markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Amplification of the Erns gene of BVDV genotype 1b.

[0039] According to the Erns gene sequence of BVDV genotype 1b, design specific primers at both ends:

[0040] B-E0-F: 5-GAGAACATAACACAATGGAACCTACAAGATAATGGGA (SEQ ID NO: 1)

[0041] B-E0-R: 5-TGCATATGCCCCAAACCATGTCTTACTCT (SEQ ID NO: 2)

[0042] The sequence of BVDV type 1b Erns gene was synthesized with reference to GenBnak (Accesion N.KC695814). According to the primers designed above, the fragment was amplified, and amplified using a high-fidelity enzyme to obtain the fragment ( figure 2 ). Among them, B in the primer name means BVDV, E0 means the gene Erns, F means the upstream primer, and R means the downstream primer. The obtained fragments were cloned on the pEASY-Blunt vector of TransGen (Company) for sequencing.

Embodiment 2

[0043] Example 2: Construction of recombinant chimeric plasmid pA-B-Erns-F123.

[0044] The CSFV CORE C-terminal and E1N-terminal 20bp bases were introduced into the BVDV Erns fragment, and the following two specific primers were used to amplify the sequence carrying the homologous fragment.

[0045] Upstream primer B-H-E0-F (SEQ ID NO: 3):

[0046] 5'-TGTACCAACCAGTTGAAGCCGAGAACATAACACAATGGAACCTACAAGATAATGGGA

[0047] Downstream primer B-H-E0-R (SEQ ID NO: 4):

[0048] 5'-ACATTACAGTAAGGCGATAGTGCATATGCCCCAAACCATGTCTTACTCT

[0049] Among them, B in the primer name means BVDV, E0 means gene Erns, H means increase homologous sequence, F means upstream primer, R means downstream primer.

[0050] Use the following two specific primers to amplify gene fragments other than Erns using the recombinant plasmid pA-F123 containing the 5' half-length genome of CSFV vaccine C strain as a template;

[0051] Upstream primer F123-F (SEQ ID NO: 5):

[0052] 5'-CTATCGCCTTACTGTAATGTAACAAGCAAG...

Embodiment 3

[0058] Example 3: Construction of the full-length cDNA of the recombinant chimeric plasmid pA-B-Erns-FL.

[0059] (1) The F456 fragment containing the 3' half-length of the genome of the CSFV vaccine C strain was excised from the recombinant plasmid pB-F456 with restriction endonucleases BamH Ⅰ and Sal Ⅰ, and the digested product was recovered by tapping and cloned in From the pA-B-Erns-F123 with the same enzyme action, the infectious cDNA vector pA-B-Erns-FL carrying the BVDV Erns gene was obtained, and identified by digestion with BamHI and SalⅠ, the size was the same ( figure 2 ); The bacteria containing the full-length cDNA were serially subcultured, and the replacement region was sequenced after the plasmid was extracted from the 10th generation of bacteria, and the sequencing results were consistent with expectations. This result shows that the infectious cDNA vector carrying BVDVErns gene constructed by the present invention is stable in the host bacteria.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology and aims to provide a method for constructing a molecularly marked CSFV (classical swine fever virus) attenuated vaccine. The method comprises following steps: a recombinant plasmid pA-F123 containing genome 5' half-length of a CSFV vaccine strain C and a recombinant plasmid pE-B-Erns containing Erns genes of a BVDV (bovine viral diarrhea virus) strain VEDEVAC are taken as templates, 20bp of homologous fragments are designed at two ends, and by means of a one-step orient cloning kit, a recombinant plasmid pA-B-Erns-F123 is obtained; an F456 fragment containing genome 3' half-length of the CSFV vaccine strain C is cut off from a recombinant plasmid pB-F456 through BamH I and Sal I and cloned into pA-B-Erns-F123 under the action of the same enzyme, and a recombinant plasmid pA-B-Erns-FL is obtained. By virtue of establishment of a reverse genetic manipulation technology, a new way is developed for research of CSFV gene functions and novel vaccines. An exogenous tag is inserted into a viral genome with the reverse genetic manipulation technology for research of virus replication, virus encoded protein functions and anti-virus drug screening, and an RNA (ribonucleic acid) polymerase II system can efficiently and stably save CSFV infectious cDNA (complementary deoxyribonucleic acid ) cloning.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for constructing a molecularly marked CSFV attenuated vaccine, and belongs to the field of rescue and application of recombinant CSFV carrying bovine viral diarrhea virus Erns gene. Background technique [0002] Classical Swine Fever (CSF) is a contact and fatal infectious disease caused by Classical Swine Fever Virus (CSFV). It is characterized by high fever and hemorrhage, and its morbidity and mortality are extremely high. It is listed as an animal disease that must be declared by the World Organization for Animal Health (OIE). Swine fever is a serious hazard to the pig industry and often causes huge economic losses. [0003] CSFV is a member of the genus Pestivirus of the Flaviviridae family. The CSFV genome is a single-stranded positive-strand linear RNA molecule with a genome size of 12.3 kb. The 3' UTR contains a large open reading frame (Open Reading Frame, ORF) in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/40C12N7/01A61K39/187A61P31/14
CPCA61K39/187C07K14/1816C12N7/00C12N2770/24334
Inventor 方维焕廖迅李肖梁
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com