Signal peptide and application thereof in production of L-arginine recombinant bacterium by means of starch
A technology of signal peptide and starch, which is applied in the fields of protein and enzyme engineering, metabolic engineering, and genetic engineering, and can solve the problems that starch cannot be used directly
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1: Primer Design of Signal Peptide Primer in Tandem with α-Amylase
[0020] According to the related gene sequence and α-amyase gene sequence published on NCBI, the signal peptide and gene tandem large fragment primers were designed.
[0021] P1: pMSPamyHindIIIF
[0022] 5'-CC AAGCTT ATGTTCAAAGAAGCACACCATCTCCCTGCTGATCATCTTCCTGCTGGCTTCCGCTGTTCTGGCTAAGCCAATCGAGGCTGCCCCGCCCGGGGCGAAGGAC-3’
[0023] P2: pMSPamyBamHIR
[0024] 5'-CGC GGATCC TTAGTTGCGCCAGGTGTCGTTGA-3
Embodiment 2
[0025] Example 2: Signal peptide replacement of α-amylase gene and its cloning
[0026] [1] Chromosome was extracted from Streptomyceskathirae CCTCCM2012432 as template DNA.
[0027] [2] Design signal peptide and gene tandem PCR primers according to the α-amylase gene sequence published on the NCBI website. Using the genome of StreptomyceskathiraeCCTCCM2012432 as a template, the α-amylase gene with a code-optimized nucleotide sequence such as the Mannasesignalpeptide (abbreviated as MSP) signal peptide shown in SEQ ID NO: 1 was obtained by PCR with large fragment primers. PCR amplification system (50 μL): template 1 μL, upstream and downstream primers 0.5 μL, dNTPMix 4 μL, 10×ExTaqBuffer 5 μL, sterilized ddH2O 38.5 μL, ExTaq DNA polymerase 0.5 μL. PCR reaction conditions: 94°C pre-denaturation, 5min, one cycle; 94°C denaturation, 30s, 56°C annealing, 30s, 72°C extension, 1min30s, 30 cycles; 72°C, 10min, one cycle; 4°C, 10min, one cycle Cycling (in which annealing temperature...
Embodiment 3
[0028] Embodiment 3: Construction of recombinant plasmid pXMJ19-MSPamy
[0029] [1] Construct the recombinant plasmid pMD18-T-MSPamy and introduce it into E.coliJM109. The product recovered by PCR in [2] was connected to the cloning vector pMD18-T, the connection system was 5 μL of solutionI, 4.8 μL of the target gene, 0.2 μL of the pMD18-T plasmid, and ligated overnight at 16°C. The ligation product was transformed into E.coilJM109, spread on an LB plate containing 100ug / mL ampicillin, cultured overnight at 37°C, picked a single colony into 10mL liquid LB medium containing 100ug / mL ampicillin, and shaken at 37°C After culturing overnight, the plasmid was extracted and named pMD18-T-MSPamy. After PCR and restriction enzyme digestion verified that the connection was successful, the bacterial liquid was added to glycerol and stored in a -70°C refrigerator.
[0030] [2] The pMD18-T-MSPamy plasmid extracted in [1] and the expression vector pXMJ19 were subjected to double digestio...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com