A method for constructing a mouse model expressing hepatitis B virus receptor-human ntcp
A construction method and mouse model technology, which can be applied to other methods of inserting foreign genetic materials, recombinant DNA technology, animal husbandry, etc., which can solve the lack of continuous and stable expression of human NTCP mouse model, lack of expression of human NTCP mouse model and other issues, to achieve the effect of an advanced evaluation system, technical platform, and rich research methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The human NTCP gene eukaryotic expression frame was obtained from pcDNA6-hNTCP by PCR technology, and the BglII-SalI double restriction site was introduced, and then it was inserted between the attB and attP sites of the plasmid zy781, and after the action of the arabinose-induced recombinase ФC31 The minicircle DNA (pMC-CMV-hNTCP) carrying the human NTCP eukaryotic expression cassette was obtained.
[0039] S1. Obtaining the eukaryotic expression cassette of the human NTCP gene: using the pcDNA6-hNTCP plasmid (the plasmid sequence is shown in SEQ ID NO: 1) as a template, design and amplify the forward direction of the eukaryotic expression cassette of the human NTCP gene (with BglII digestion) site) and reverse primer (with SalI restriction site):
[0040] Forward primer F: 5'- GAAGATCTCCCGATCCCCTAT -3'
[0041] Reverse primer R: 5'- ACGCGTCGACCCATAGAGCCCACC -3'
[0042] The PCR reaction system and reaction procedure are as follows:
[0043]
[0044] Reaction con...
Embodiment 3
[0064] The present invention also uses conventional eukaryotic expression vectors in the field to mediate human NTCP gene preparation animal models, for example, the eukaryotic recombinant expression vector pcDNA6-hNTCP is also introduced into ICR mice by hydrodynamic transfection technology to prepare and express human NTCP genetic mouse model. However, it was found that when the conventional eukaryotic expression vector was used to mediate the human NTCP gene, the prepared mouse model could not continuously express the human NTCP gene, and could not meet the quality requirements of the animal model. And adopt the plasmid ZY781 mentioned in the present invention and engineering bacterium E. coli ZYCY10P3S2T is used to prepare the microcircle eukaryotic expression vector carrying human NTCP, optimize the induction microcircle production conditions, and finally obtain the microcircle eukaryotic expression vector carrying human NTCP in one step, reducing steps, eliminating the ...
Embodiment 4
[0065] Example 4 A mouse model expressing human NTCP was prepared using the minicircle pMC-hNTCP carrying the eukaryotic expression cassette of human NTCP gene.
[0066] 1. Preparation of human NTCP gene-transfected mice by hydrodynamic transfection technology: Select 6-8 week old ICR mice with a body weight of 26-28 g. Divided into three groups: experimental group, control group, blank control group. In the experimental group, 15 μg of microcircle DNA carrying the human NTCP eukaryotic expression cassette was dissolved in 2.5 ml of normal saline, in the control group, 15 μg of pcDNA was dissolved in 2.5 ml of normal saline, and in the blank control group, 2.5 ml of normal saline was dissolved, and both were injected via the tail vein of the mice. Inject into mice within 5-8s.
[0067] 2. PCR screening and identification of gene-transfected mice: On the 1st and 14th day, respectively, 2 mice in each group were taken to collect liver tissue, and the liver tissue DNA was extrac...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com