Expression system of a xylose-utilizing yeast spathaspora passalidarum
An expression system and xylose technology, applied in the field of genetic engineering, can solve the problem that conventional expression vectors are difficult to apply to yeast expression system and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0093] Example 1: Construction of PR series integrated expression vectors
[0094] 1. Construction of recombinant plasmid pMD-18s rDNA
[0095] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.
[0096] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'
[0097] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'
[0098] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.
[0099] (3) Spathaspora passalidarum host bacterial genome DNA was used as a template, and primers P1 and P2 were used for PCR am...
Embodiment 2
[0158] Example 2: Establishment of PEG / LiAc-mediated transformation method of Spathaspora passalidarum.
[0159] Using Spathaspora passalidarum NRRL Y-27907 as the host bacterium, the method of using PEG / LiAc to mediate the transformation of yeast is implemented as follows:
[0160] 1. Preparation of competent state of Spathaspora passalidarum NRRL Y-27907
[0161] (1) Inoculate the Spathaspora passalidarum NRRL Y-27907 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours.
[0162] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.
[0163] (3) Pick a single colony of Spathaspora passalidarum NRRL Y-27907 from a YPD plate, inoculate it in 20 ml of YPD medium, and culture it overnight at 30° C. in a 100 ml shaker flask.
[0164] (4) Inoculate 50ml of YPD culture medium with the fresh bacterial solution cultivated overnight, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of t...
Embodiment 3
[0180] Example 3: Establishment of electroporation-mediated yeast Spathaspora passalidarum transformation method
[0181] Using Spathaspora passalidarum NRRL Y-27907 as the host bacterium, the implementation of yeast transformation mediated by electroporation is as follows:
[0182] 1. Preparation of Spathaspora passalidarum NRRL Y-27907 electroporation competent cells
[0183] (1) Inoculate the Spathaspora passalidarum NRRL Y-27907 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours;
[0184] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C;
[0185](3) Pick a single colony of Spathaspora passalidarum NRRL Y-27907 from the YPD plate, inoculate it in 20ml YPD medium, and culture it overnight at 30°C in a 100ml shake flask;
[0186] (4) Inoculate the overnight cultured fresh bacterial solution into 50ml YPD medium, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bact...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com