Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression system of a xylose-utilizing yeast spathaspora passalidarum

An expression system and xylose technology, applied in the field of genetic engineering, can solve the problem that conventional expression vectors are difficult to apply to yeast expression system and so on

Active Publication Date: 2019-03-15
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are a variety of expression vectors on the market for expression systems such as Saccharomyces cerevisiae and Pichia pastoris, this yeast uses a special gene coding system, and the codon CUG codes for serine instead of leucine (Wohlbach DJ, Kuo A, Sato TK , Potts KM, Salamov AA, Labutti KM, Sun H, Clum A, Pangilinan JL, Lindquist EA, Lucas S, Lapidus A, Jin M, Gunawan C, Balan V, Dale BE, Jeffries TW, Zinkel R, Barry KW, Grigoriev IV , GaschAP.Comparative genomics of xylose-fermenting fungi for enhanced biofuelproduction.Proceedings of the National Academy of Sciences of the United States of America,2011,108(32):13212-13217.), so the above-mentioned conventional expression vectors are difficult to modify Suitable for this yeast expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression system of a xylose-utilizing yeast spathaspora passalidarum
  • Expression system of a xylose-utilizing yeast spathaspora passalidarum
  • Expression system of a xylose-utilizing yeast spathaspora passalidarum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] Example 1: Construction of PR series integrated expression vectors

[0094] 1. Construction of recombinant plasmid pMD-18s rDNA

[0095] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.

[0096] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'

[0097] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'

[0098] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.

[0099] (3) Spathaspora passalidarum host bacterial genome DNA was used as a template, and primers P1 and P2 were used for PCR am...

Embodiment 2

[0158] Example 2: Establishment of PEG / LiAc-mediated transformation method of Spathaspora passalidarum.

[0159] Using Spathaspora passalidarum NRRL Y-27907 as the host bacterium, the method of using PEG / LiAc to mediate the transformation of yeast is implemented as follows:

[0160] 1. Preparation of competent state of Spathaspora passalidarum NRRL Y-27907

[0161] (1) Inoculate the Spathaspora passalidarum NRRL Y-27907 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours.

[0162] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.

[0163] (3) Pick a single colony of Spathaspora passalidarum NRRL Y-27907 from a YPD plate, inoculate it in 20 ml of YPD medium, and culture it overnight at 30° C. in a 100 ml shaker flask.

[0164] (4) Inoculate 50ml of YPD culture medium with the fresh bacterial solution cultivated overnight, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of t...

Embodiment 3

[0180] Example 3: Establishment of electroporation-mediated yeast Spathaspora passalidarum transformation method

[0181] Using Spathaspora passalidarum NRRL Y-27907 as the host bacterium, the implementation of yeast transformation mediated by electroporation is as follows:

[0182] 1. Preparation of Spathaspora passalidarum NRRL Y-27907 electroporation competent cells

[0183] (1) Inoculate the Spathaspora passalidarum NRRL Y-27907 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours;

[0184] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C;

[0185](3) Pick a single colony of Spathaspora passalidarum NRRL Y-27907 from the YPD plate, inoculate it in 20ml YPD medium, and culture it overnight at 30°C in a 100ml shake flask;

[0186] (4) Inoculate the overnight cultured fresh bacterial solution into 50ml YPD medium, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a yeast spathaspora passalidarum expression system capable of utilizing xylose. The yeast spathaspora passalidarum expression system comprises an annular novel expression vector which is sequentially and operably linked to the following elements from 5' to 3': a pMD19-Tsimple plasmid backbone, rDNA homologous recombination sequences, an exogenous gene expression cassette and a selective marker gene expression cassette, wherein the exogenous gene expression cassette sequentially comprises a promoter, an exogenous gene insertion enzyme cleavage site and a transcriptional terminator from upstream to downstream; the selective marker gene expression cassette comprises a promoter, an antibiotic resistance gene and a transcription terminator. The yeast capable of utilizing xylose is spathaspora passalidarum. The integrated stable expression of the expression vector in spathaspora passalidarum can be achieved and the expression vector is of great significance for basic research on the yeast spathaspora passalidarum capable of utilizing xylose and the development of products.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an expression system of yeast Spathaspora passalidarum capable of utilizing xylose, a construction method and application thereof. Background technique [0002] Yeast is a low-level single-celled eukaryotic organism. It not only has the characteristics of prokaryotic organisms such as easy cultivation, fast reproduction, and convenient genetic engineering operations, but also has the functions of eukaryotic protein processing, folding, and post-translational modification. In particular, the methanol yeast gene expression system developed rapidly in recent years has the advantages of genetic stability, high-density fermentation, high expression level, and easy purification. Therefore, yeast has become the most important tool and model for modern molecular biology research, especially suitable for expressing eukaryotic genes and preparing functional proteins. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81C12N15/66C12N1/19C12R1/645
Inventor 张梁范贺超高芝李由然石贵阳顾正华李赢丁重阳何冬旭
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com